ID: 1165338093

View in Genome Browser
Species Human (GRCh38)
Location 19:35187314-35187336
Sequence GCCTCAGGTTCCCGAGTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165338093_1165338100 9 Left 1165338093 19:35187314-35187336 CCAACTACTCGGGAACCTGAGGC No data
Right 1165338100 19:35187346-35187368 CCCTTGAACCTGGGAGGCAGAGG 0: 423
1: 19465
2: 58168
3: 109530
4: 133258
1165338093_1165338096 0 Left 1165338093 19:35187314-35187336 CCAACTACTCGGGAACCTGAGGC No data
Right 1165338096 19:35187337-35187359 AAGATAATCCCCTTGAACCTGGG No data
1165338093_1165338095 -1 Left 1165338093 19:35187314-35187336 CCAACTACTCGGGAACCTGAGGC No data
Right 1165338095 19:35187336-35187358 CAAGATAATCCCCTTGAACCTGG No data
1165338093_1165338097 3 Left 1165338093 19:35187314-35187336 CCAACTACTCGGGAACCTGAGGC No data
Right 1165338097 19:35187340-35187362 ATAATCCCCTTGAACCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165338093 Original CRISPR GCCTCAGGTTCCCGAGTAGT TGG (reversed) Intergenic
No off target data available for this crispr