ID: 1165338096

View in Genome Browser
Species Human (GRCh38)
Location 19:35187337-35187359
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165338091_1165338096 1 Left 1165338091 19:35187313-35187335 CCCAACTACTCGGGAACCTGAGG No data
Right 1165338096 19:35187337-35187359 AAGATAATCCCCTTGAACCTGGG No data
1165338090_1165338096 9 Left 1165338090 19:35187305-35187327 CCTCTAATCCCAACTACTCGGGA 0: 11
1: 1790
2: 56608
3: 231362
4: 262047
Right 1165338096 19:35187337-35187359 AAGATAATCCCCTTGAACCTGGG No data
1165338093_1165338096 0 Left 1165338093 19:35187314-35187336 CCAACTACTCGGGAACCTGAGGC No data
Right 1165338096 19:35187337-35187359 AAGATAATCCCCTTGAACCTGGG No data
1165338087_1165338096 28 Left 1165338087 19:35187286-35187308 CCTGGCGTGCTGGCAGGCACCTC No data
Right 1165338096 19:35187337-35187359 AAGATAATCCCCTTGAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165338096 Original CRISPR AAGATAATCCCCTTGAACCT GGG Intergenic
No off target data available for this crispr