ID: 1165338100

View in Genome Browser
Species Human (GRCh38)
Location 19:35187346-35187368
Sequence CCCTTGAACCTGGGAGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320844
Summary {0: 423, 1: 19465, 2: 58168, 3: 109530, 4: 133258}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165338094_1165338100 -6 Left 1165338094 19:35187329-35187351 CCTGAGGCAAGATAATCCCCTTG No data
Right 1165338100 19:35187346-35187368 CCCTTGAACCTGGGAGGCAGAGG 0: 423
1: 19465
2: 58168
3: 109530
4: 133258
1165338090_1165338100 18 Left 1165338090 19:35187305-35187327 CCTCTAATCCCAACTACTCGGGA 0: 11
1: 1790
2: 56608
3: 231362
4: 262047
Right 1165338100 19:35187346-35187368 CCCTTGAACCTGGGAGGCAGAGG 0: 423
1: 19465
2: 58168
3: 109530
4: 133258
1165338091_1165338100 10 Left 1165338091 19:35187313-35187335 CCCAACTACTCGGGAACCTGAGG No data
Right 1165338100 19:35187346-35187368 CCCTTGAACCTGGGAGGCAGAGG 0: 423
1: 19465
2: 58168
3: 109530
4: 133258
1165338093_1165338100 9 Left 1165338093 19:35187314-35187336 CCAACTACTCGGGAACCTGAGGC No data
Right 1165338100 19:35187346-35187368 CCCTTGAACCTGGGAGGCAGAGG 0: 423
1: 19465
2: 58168
3: 109530
4: 133258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165338100 Original CRISPR CCCTTGAACCTGGGAGGCAG AGG Intergenic
Too many off-targets to display for this crispr