ID: 1165339780

View in Genome Browser
Species Human (GRCh38)
Location 19:35203149-35203171
Sequence ATCTCTTGAGACTGTACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165339780_1165339781 -2 Left 1165339780 19:35203149-35203171 CCTGGGGTACAGTCTCAAGAGAT No data
Right 1165339781 19:35203170-35203192 ATCCTGAGAACATGTGCCTGAGG No data
1165339780_1165339785 1 Left 1165339780 19:35203149-35203171 CCTGGGGTACAGTCTCAAGAGAT No data
Right 1165339785 19:35203173-35203195 CTGAGAACATGTGCCTGAGGGGG 0: 10
1: 37
2: 500
3: 815
4: 1345
1165339780_1165339782 -1 Left 1165339780 19:35203149-35203171 CCTGGGGTACAGTCTCAAGAGAT No data
Right 1165339782 19:35203171-35203193 TCCTGAGAACATGTGCCTGAGGG No data
1165339780_1165339786 6 Left 1165339780 19:35203149-35203171 CCTGGGGTACAGTCTCAAGAGAT No data
Right 1165339786 19:35203178-35203200 AACATGTGCCTGAGGGGGTCAGG No data
1165339780_1165339788 17 Left 1165339780 19:35203149-35203171 CCTGGGGTACAGTCTCAAGAGAT No data
Right 1165339788 19:35203189-35203211 GAGGGGGTCAGGTTACAGTTTGG No data
1165339780_1165339784 0 Left 1165339780 19:35203149-35203171 CCTGGGGTACAGTCTCAAGAGAT No data
Right 1165339784 19:35203172-35203194 CCTGAGAACATGTGCCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165339780 Original CRISPR ATCTCTTGAGACTGTACCCC AGG (reversed) Intergenic
No off target data available for this crispr