ID: 1165340970

View in Genome Browser
Species Human (GRCh38)
Location 19:35211980-35212002
Sequence CAAGCTGAAGCCTGCCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165340970_1165340982 25 Left 1165340970 19:35211980-35212002 CCTGCAGGGCAGGCTTCAGCTTG No data
Right 1165340982 19:35212028-35212050 CGTGGGCACACCCAGGCAGAGGG No data
1165340970_1165340974 8 Left 1165340970 19:35211980-35212002 CCTGCAGGGCAGGCTTCAGCTTG No data
Right 1165340974 19:35212011-35212033 CGGCCCAGAACAGTCCCCGTGGG No data
1165340970_1165340973 7 Left 1165340970 19:35211980-35212002 CCTGCAGGGCAGGCTTCAGCTTG No data
Right 1165340973 19:35212010-35212032 GCGGCCCAGAACAGTCCCCGTGG No data
1165340970_1165340981 24 Left 1165340970 19:35211980-35212002 CCTGCAGGGCAGGCTTCAGCTTG No data
Right 1165340981 19:35212027-35212049 CCGTGGGCACACCCAGGCAGAGG No data
1165340970_1165340977 18 Left 1165340970 19:35211980-35212002 CCTGCAGGGCAGGCTTCAGCTTG No data
Right 1165340977 19:35212021-35212043 CAGTCCCCGTGGGCACACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165340970 Original CRISPR CAAGCTGAAGCCTGCCCTGC AGG (reversed) Intergenic
No off target data available for this crispr