ID: 1165340975

View in Genome Browser
Species Human (GRCh38)
Location 19:35212014-35212036
Sequence GTGCCCACGGGGACTGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165340975_1165340981 -10 Left 1165340975 19:35212014-35212036 CCCAGAACAGTCCCCGTGGGCAC No data
Right 1165340981 19:35212027-35212049 CCGTGGGCACACCCAGGCAGAGG No data
1165340975_1165340986 27 Left 1165340975 19:35212014-35212036 CCCAGAACAGTCCCCGTGGGCAC No data
Right 1165340986 19:35212064-35212086 CTGACCCAGCTTCCAAAGCCAGG No data
1165340975_1165340982 -9 Left 1165340975 19:35212014-35212036 CCCAGAACAGTCCCCGTGGGCAC No data
Right 1165340982 19:35212028-35212050 CGTGGGCACACCCAGGCAGAGGG No data
1165340975_1165340987 28 Left 1165340975 19:35212014-35212036 CCCAGAACAGTCCCCGTGGGCAC No data
Right 1165340987 19:35212065-35212087 TGACCCAGCTTCCAAAGCCAGGG No data
1165340975_1165340984 1 Left 1165340975 19:35212014-35212036 CCCAGAACAGTCCCCGTGGGCAC No data
Right 1165340984 19:35212038-35212060 CCCAGGCAGAGGGTTTTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165340975 Original CRISPR GTGCCCACGGGGACTGTTCT GGG (reversed) Intergenic
No off target data available for this crispr