ID: 1165340981

View in Genome Browser
Species Human (GRCh38)
Location 19:35212027-35212049
Sequence CCGTGGGCACACCCAGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165340970_1165340981 24 Left 1165340970 19:35211980-35212002 CCTGCAGGGCAGGCTTCAGCTTG No data
Right 1165340981 19:35212027-35212049 CCGTGGGCACACCCAGGCAGAGG No data
1165340969_1165340981 28 Left 1165340969 19:35211976-35211998 CCTGCCTGCAGGGCAGGCTTCAG No data
Right 1165340981 19:35212027-35212049 CCGTGGGCACACCCAGGCAGAGG No data
1165340975_1165340981 -10 Left 1165340975 19:35212014-35212036 CCCAGAACAGTCCCCGTGGGCAC No data
Right 1165340981 19:35212027-35212049 CCGTGGGCACACCCAGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165340981 Original CRISPR CCGTGGGCACACCCAGGCAG AGG Intergenic
No off target data available for this crispr