ID: 1165342413

View in Genome Browser
Species Human (GRCh38)
Location 19:35222546-35222568
Sequence CTGGGTGTCTACTTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165342413_1165342426 23 Left 1165342413 19:35222546-35222568 CCGTCCACCAAGTAGACACCCAG No data
Right 1165342426 19:35222592-35222614 CCTGTGCCTGCAACTGCTTGGGG No data
1165342413_1165342424 22 Left 1165342413 19:35222546-35222568 CCGTCCACCAAGTAGACACCCAG No data
Right 1165342424 19:35222591-35222613 GCCTGTGCCTGCAACTGCTTGGG No data
1165342413_1165342427 27 Left 1165342413 19:35222546-35222568 CCGTCCACCAAGTAGACACCCAG No data
Right 1165342427 19:35222596-35222618 TGCCTGCAACTGCTTGGGGTAGG No data
1165342413_1165342423 21 Left 1165342413 19:35222546-35222568 CCGTCCACCAAGTAGACACCCAG No data
Right 1165342423 19:35222590-35222612 TGCCTGTGCCTGCAACTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165342413 Original CRISPR CTGGGTGTCTACTTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr