ID: 1165342843

View in Genome Browser
Species Human (GRCh38)
Location 19:35224902-35224924
Sequence GCTGCTCGTGGTCACCGTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165342843_1165342850 22 Left 1165342843 19:35224902-35224924 CCAGGACGGTGACCACGAGCAGC 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1165342850 19:35224947-35224969 CGGAGTCCGCCCTGCCCCGCAGG 0: 1
1: 0
2: 1
3: 4
4: 188
1165342843_1165342846 2 Left 1165342843 19:35224902-35224924 CCAGGACGGTGACCACGAGCAGC 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1165342846 19:35224927-35224949 CAGCTTCAGCCCCTTGAGCACGG 0: 1
1: 0
2: 0
3: 29
4: 311
1165342843_1165342851 23 Left 1165342843 19:35224902-35224924 CCAGGACGGTGACCACGAGCAGC 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1165342851 19:35224948-35224970 GGAGTCCGCCCTGCCCCGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165342843 Original CRISPR GCTGCTCGTGGTCACCGTCC TGG (reversed) Exonic
901023164 1:6265273-6265295 GCTGCACACGGTCACCGCCCCGG + Intronic
901057679 1:6456297-6456319 GCTGCTCAAGGCCACAGTCCTGG - Intronic
902092261 1:13912966-13912988 GCAGCTCCTGGTCCCCGCCCAGG - Intergenic
902193851 1:14783404-14783426 GCTTCTCGGGGTCACCGTGAAGG - Intronic
902476674 1:16692158-16692180 GCTGCTCAAGGCCACAGTCCTGG + Intergenic
902786629 1:18736892-18736914 GCTGCTGGTGGCCACTGTGCTGG + Intronic
904659188 1:32072346-32072368 GCTGCTGATGGTCACCGTGTAGG - Intronic
912962812 1:114211156-114211178 GCTGCTAGTGTTCCCCTTCCAGG + Intergenic
913486478 1:119336283-119336305 GCTGCTCCTGTTCACCATGCAGG - Intergenic
1062799633 10:369518-369540 GCTGTCCGTGCTCACCGTGCAGG - Exonic
1063088057 10:2837177-2837199 GCTGGGCGTGGGCACTGTCCTGG - Intergenic
1067440578 10:46307174-46307196 GCTGCTTGGTGTCACCATCCTGG - Intronic
1076903223 10:133350095-133350117 GCTCCTCCTGGTCACCAGCCTGG + Exonic
1077469730 11:2751549-2751571 ACTGCTGGTGGGCACCATCCCGG + Intronic
1077555048 11:3221939-3221961 CCTCCTCGAGGTCACCGTCCAGG + Intergenic
1083622644 11:64056674-64056696 GCTGCTGGTGGGCACAGCCCCGG - Intronic
1083800028 11:65041307-65041329 GCTGCCCGTGGGCACCTGCCCGG + Exonic
1088883503 11:113989652-113989674 GCTGCGCGTGGGCTCCGTGCTGG + Exonic
1089208863 11:116787715-116787737 GCTCCTCGGGGTCCCCGGCCGGG + Intronic
1089561615 11:119346049-119346071 GCTGCTGGTGGCCATCATCCTGG - Exonic
1089826863 11:121285550-121285572 GCTGAGGGTAGTCACCGTCCAGG + Intergenic
1090616219 11:128517783-128517805 CCAGCTCGTGGTCAACCTCCCGG - Intronic
1099420245 12:82449400-82449422 GCTGCCCATGCACACCGTCCTGG + Intronic
1102370935 12:112382008-112382030 GCTGATCCGGGTCACCGACCTGG - Exonic
1104906342 12:132215454-132215476 GCTGCTTGTGCTCTCCGTCGAGG - Intronic
1108853535 13:54765502-54765524 GCTTCTCCTGGTCATCCTCCAGG + Intergenic
1114459215 14:22876307-22876329 CCTGCTCCTGGTCATCGCCCTGG + Exonic
1118262506 14:64260581-64260603 GCAGCTAGTGCTCACCCTCCTGG - Exonic
1121111099 14:91313712-91313734 GCTGCTTGTTGTCACGCTCCAGG + Exonic
1124636332 15:31367155-31367177 GCTGCTCCTTGTCAGCCTCCTGG + Intronic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1132557996 16:580863-580885 GCTCCTGGTGGTCGCCGTGCAGG + Exonic
1132715982 16:1289997-1290019 GCTGCTGGAGGTGACTGTCCCGG + Intergenic
1136666838 16:31819690-31819712 GCTGCTCCTGGGCTCCGGCCAGG + Intergenic
1142692434 17:1614886-1614908 CCTGCTCTTGGACACTGTCCTGG - Intronic
1143921522 17:10334077-10334099 GGTGCTCGTGGTAACCAGCCTGG + Intronic
1149370624 17:55990640-55990662 GCTGCTTATGGTCACTGTCCTGG - Intergenic
1150433698 17:65138562-65138584 GATGCTCGTGCTCATCTTCCGGG + Intronic
1152073366 17:78144951-78144973 TCTGCCCCTGGGCACCGTCCAGG - Intergenic
1152088028 17:78232041-78232063 GCTGCTCCTGGCCGCCGCCCTGG + Exonic
1154218579 18:12433204-12433226 GCTGCTCGTGCGCAGGGTCCGGG + Intergenic
1157281561 18:46349610-46349632 GCTGCCAGTGGTCACAGTTCTGG + Intronic
1157451423 18:47792014-47792036 GCTGCCCCTGCTCACCTTCCTGG + Intergenic
1160723931 19:609247-609269 GCTGCCGGGGGGCACCGTCCTGG + Intronic
1161693004 19:5748161-5748183 TCAGCTCGTCGACACCGTCCGGG + Exonic
1162281619 19:9702655-9702677 GCTGGTCGTGGTCCCCCTCAGGG - Intergenic
1165342843 19:35224902-35224924 GCTGCTCGTGGTCACCGTCCTGG - Exonic
1168269370 19:55241313-55241335 GCTGCACGTGGTCAAGCTCCTGG - Exonic
1202710695 1_KI270714v1_random:17999-18021 GCTGCTCAAGGCCACAGTCCTGG + Intergenic
926253586 2:11170373-11170395 GCTGGTGGTGGTCAGCGTCGAGG + Intronic
928123486 2:28600545-28600567 GTTGCTCATGGTCACCTTTCTGG - Intronic
931586406 2:63834616-63834638 GCTCCTCTTGGCCACCTTCCAGG - Intergenic
933015143 2:77114736-77114758 GCAGCTCGGGGTCACCATCATGG - Intronic
935376190 2:102400046-102400068 GCTGATAGTGATCACAGTCCAGG + Intergenic
936954172 2:118007855-118007877 GCTCCACGGGGTCACAGTCCTGG - Intronic
947816765 2:233042623-233042645 GCTGCTCGAGGACAGCCTCCTGG + Intergenic
1180603160 22:17036189-17036211 GCGGCTCGTGCTCCCCGGCCAGG + Intergenic
1182669884 22:31987071-31987093 GCTGTGCTTGGTCACCTTCCAGG - Intergenic
1183547342 22:38461528-38461550 GCGGCTTGTGGCCACCGTCAGGG + Intergenic
1184235861 22:43182677-43182699 TTTGCTCGAGGTCACCCTCCAGG - Intronic
1184531714 22:45060462-45060484 GGAGCTCGAGGTCCCCGTCCAGG + Intergenic
1185089487 22:48757738-48757760 GCTGCTGGTGGGCACTGGCCAGG + Intronic
1185345869 22:50310346-50310368 GCTCCCCTTGGTCACCCTCCCGG + Exonic
952403634 3:32986171-32986193 GCTGCTCCTGCTCATCGTTCAGG + Intergenic
954151045 3:48657295-48657317 GCTGCGCGTGGTCATCATCACGG - Exonic
954293779 3:49663093-49663115 GCCGCCCGTGGTCACCGTGCCGG - Exonic
961812972 3:129532392-129532414 GCAGCTCGTCTTCACCGTCAAGG + Exonic
967329026 3:188271985-188272007 GCTGCTTGTGGTCCCTTTCCTGG + Intronic
970251745 4:14123891-14123913 GCTGCTAGTAGCCACCCTCCTGG - Intergenic
972686982 4:41361055-41361077 GCTGCTCCAGGTCACCCCCCCGG + Intronic
985611401 5:891596-891618 GCTCCTCGTGGGCAGCGTCCGGG + Intronic
990317921 5:54601612-54601634 GCTGCTGCTGGTCACTGTCCTGG - Intergenic
998970025 5:147580916-147580938 GCGGCTCGAGGTCACCATCACGG + Intergenic
1019603499 7:1897090-1897112 GCTGCACGGGGGCACCGTGCCGG - Intronic
1020326662 7:6979554-6979576 GCTGCTGCTGATCACCTTCCAGG - Intergenic
1022911085 7:34900112-34900134 TCTGCTCATCTTCACCGTCCTGG - Intergenic
1023902213 7:44490528-44490550 GCAGCACGTGGGCAACGTCCAGG - Exonic
1024005069 7:45219404-45219426 GCTCCTTGTGGGCACCGGCCCGG + Intergenic
1024579539 7:50790989-50791011 GCTGCCCTTGGTCCCAGTCCTGG + Intronic
1026916331 7:74122089-74122111 GCTGCTGGTGGACACCTGCCCGG - Exonic
1037893337 8:22635836-22635858 GCTGCTCGTCGCCTCCTTCCTGG + Intronic
1041377371 8:57217507-57217529 GCTGCTCATCGCCACCTTCCAGG + Intergenic
1049307648 8:141914286-141914308 GCTCCTCATAGTCACGGTCCTGG - Intergenic
1061480525 9:130895767-130895789 GCTGCTCTGGGTCCTCGTCCAGG + Intergenic
1062551007 9:137086502-137086524 GCTGCCCTTGGGCGCCGTCCTGG - Intergenic
1062653117 9:137588608-137588630 GATGCTCGTGGTCAGTGCCCAGG - Intronic
1185460665 X:331572-331594 GCGGCCCGTGGGCACCGTGCTGG + Intergenic
1188774554 X:34198157-34198179 GCTGCTCCTAGTCACTGACCAGG - Intergenic
1197754531 X:129984379-129984401 GCTCCTCGTCGTCGTCGTCCCGG - Intronic