ID: 1165349932

View in Genome Browser
Species Human (GRCh38)
Location 19:35269765-35269787
Sequence GAGCGGCGAGGCCGGCGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 294}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165349932_1165349937 -7 Left 1165349932 19:35269765-35269787 CCCCAGCGCCGGCCTCGCCGCTC 0: 1
1: 0
2: 1
3: 33
4: 294
Right 1165349937 19:35269781-35269803 GCCGCTCTGCCGCCCCCTGCAGG 0: 1
1: 0
2: 2
3: 28
4: 358
1165349932_1165349946 24 Left 1165349932 19:35269765-35269787 CCCCAGCGCCGGCCTCGCCGCTC 0: 1
1: 0
2: 1
3: 33
4: 294
Right 1165349946 19:35269812-35269834 CGCGTAGTCCAGGTGACTGATGG 0: 1
1: 0
2: 0
3: 3
4: 48
1165349932_1165349944 14 Left 1165349932 19:35269765-35269787 CCCCAGCGCCGGCCTCGCCGCTC 0: 1
1: 0
2: 1
3: 33
4: 294
Right 1165349944 19:35269802-35269824 GGTGACATACCGCGTAGTCCAGG 0: 1
1: 0
2: 0
3: 0
4: 12

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165349932 Original CRISPR GAGCGGCGAGGCCGGCGCTG GGG (reversed) Intronic
900110113 1:1001729-1001751 GGGCTGCGAGGCCGGAGCGGGGG + Intergenic
900119944 1:1044285-1044307 GGGCGGCGGGGACGGGGCTGCGG + Intronic
900206986 1:1435833-1435855 GGGCGGCCGGGCCGGGGCTGGGG + Intronic
900513438 1:3070633-3070655 GAGCTGCGAGGCCGGCCTGGAGG - Intronic
900786760 1:4654631-4654653 GAGCAGCGCGGGCGGCTCTGCGG + Intergenic
900971110 1:5992856-5992878 TATCCGCGAGGCCCGCGCTGCGG + Intronic
901142055 1:7041298-7041320 GACCTGCGAGGCCTGGGCTGTGG + Intronic
901638269 1:10680299-10680321 GGGGTGCGAGGCCGGCTCTGGGG + Intronic
903233877 1:21937357-21937379 CGGGGGCGGGGCCGGCGCTGCGG - Intergenic
903323417 1:22555837-22555859 GAGGGGCCAGGTCGGCACTGAGG - Intergenic
903515903 1:23910896-23910918 GAGCAGAGAGTCCTGCGCTGTGG - Intronic
903576577 1:24343021-24343043 GAGGGGTGAGGCCAGGGCTGGGG + Exonic
903646104 1:24897347-24897369 CAGAGGAGAGGCCGGGGCTGAGG + Intergenic
904256933 1:29260086-29260108 GAGGGGCGGGGCCGGCGACGGGG + Intronic
904289862 1:29478223-29478245 GAGGGGAGAGGTCAGCGCTGAGG - Intergenic
905867099 1:41382354-41382376 GCCCGGCGAGGCGGGCGCCGCGG + Exonic
906292997 1:44632040-44632062 GGCCGGCGAGGGCGGCGATGCGG - Intronic
907767393 1:57424231-57424253 GAGCCGCGAGGCCGGGGCGAGGG - Intronic
908796304 1:67833588-67833610 GAGGGGCGAGGCCTGGCCTGTGG + Intergenic
910777883 1:90893859-90893881 GAGCGGCGACTGGGGCGCTGCGG - Intergenic
910981119 1:92961166-92961188 GAGCCGCGAGGGCCGCGGTGGGG + Intronic
912993430 1:114510908-114510930 AGGCGGCAGGGCCGGCGCTGAGG - Exonic
914197335 1:145454426-145454448 GGGCGGCGGGGCCGGCGGGGCGG - Intergenic
914703020 1:150150607-150150629 GCGCGGCGAGGACGGGGCGGCGG + Intronic
916072259 1:161177173-161177195 GAGGGGCGTGGTCCGCGCTGTGG + Intronic
916694397 1:167221320-167221342 GGGCGGCGGGGCCGGGGCAGAGG + Intronic
917975115 1:180233349-180233371 GAGCGACGAGGCCCGCACCGGGG - Intronic
918487657 1:185045962-185045984 CTGCGCGGAGGCCGGCGCTGCGG + Intronic
919730144 1:200908638-200908660 GAGCGGCGAGGCATGGGCTGTGG + Intronic
920184842 1:204152934-204152956 GAGAGGCCAGGCCGGCTCAGGGG + Intergenic
920307958 1:205031071-205031093 GAGAGGGGAGGCCGGCCATGGGG + Intergenic
924421863 1:243917312-243917334 CAGCGGCGAGGTCGGGGCTGGGG + Intergenic
924706586 1:246507323-246507345 GAGGGGCGGGGCGGGCGCGGTGG + Intergenic
924798652 1:247311110-247311132 TAGTGGTGAGGCCGGCGCAGTGG + Intronic
1064209034 10:13347975-13347997 AAGCGGCGGGCCCGGCGCGGGGG - Intronic
1065022240 10:21510046-21510068 GAGCGGCAGGGCCAGCGCCGCGG - Intergenic
1069386174 10:67884927-67884949 GTGCGGCGGCGGCGGCGCTGTGG + Exonic
1073306190 10:102504706-102504728 GAGAGGCGAGGCGGGGCCTGGGG + Intronic
1075032051 10:119030082-119030104 GGGCGCTGGGGCCGGCGCTGGGG + Exonic
1075504357 10:123009007-123009029 GAGCGGAGAGGCCTGCGGCGAGG + Exonic
1076704331 10:132293124-132293146 GTGCGGGGAGGGCAGCGCTGGGG + Intronic
1077194709 11:1273597-1273619 GAGAGGCCAGACCGGCGATGGGG + Intergenic
1077225092 11:1436152-1436174 GGGAGGCGGGGCCGGCGGTGGGG + Intronic
1077492759 11:2869786-2869808 CAGCGGCGGGGCCGGCTCTGCGG + Intergenic
1077806601 11:5596564-5596586 GAGCGGCCAGGCTGGAGATGGGG - Intronic
1081938161 11:46918644-46918666 AAGGGGCCGGGCCGGCGCTGGGG - Intergenic
1082025111 11:47565821-47565843 GAGCGGCGGGGACGGGGCAGGGG - Intronic
1083332501 11:61905450-61905472 GAGCGGCCAGGCCGGCTCGTAGG + Intronic
1083779403 11:64910179-64910201 GAGCGCCGGGGTCGGCTCTGAGG + Exonic
1084420092 11:69056178-69056200 GAGCGGCAGGGCTGGCGCTGAGG - Intronic
1084959424 11:72708655-72708677 GAGTGAGGAGGCAGGCGCTGGGG + Intronic
1086561629 11:88175490-88175512 GGGCGGCGGGGCGGGGGCTGGGG + Intergenic
1086590444 11:88508957-88508979 GGGCGCCGACGCCGGGGCTGGGG + Exonic
1088172980 11:107018341-107018363 ATGCGCCGAGGCGGGCGCTGAGG - Exonic
1088332168 11:108665335-108665357 AAAAGGTGAGGCCGGCGCTGGGG + Exonic
1088481067 11:110296704-110296726 GAGCGCCAACGCCGCCGCTGGGG + Exonic
1089729642 11:120512049-120512071 GAGCGGGGAGGAGGGCGCGGGGG - Intronic
1091689429 12:2585519-2585541 GAGCTGTGAGGCCGGTGCTGGGG + Intronic
1091823258 12:3491752-3491774 GAGCGGCGGCGGCGGCGCGGTGG - Intronic
1096674379 12:53218778-53218800 GGGCGGGGCGGCGGGCGCTGGGG - Intronic
1097166446 12:57088936-57088958 GGCCGGGGAGGCGGGCGCTGGGG - Exonic
1097190395 12:57216790-57216812 GAGGCGCGGAGCCGGCGCTGGGG - Exonic
1101340997 12:103841514-103841536 GAGCTGGGCGGGCGGCGCTGGGG - Exonic
1101504004 12:105330494-105330516 AAGGGGCGTGGCCGGCGCAGCGG - Intronic
1102370882 12:112381852-112381874 GGGAGGCGAGGCCGCGGCTGAGG + Intronic
1103407718 12:120687395-120687417 GGCCGGCGTGGCCGGCGCGGCGG + Exonic
1105413838 13:20192798-20192820 GCGCGGCGGGGCCGGGGCGGGGG + Intronic
1106057725 13:26254312-26254334 GAGCGGCGGAGCCGGCGCCCAGG + Exonic
1106304069 13:28494946-28494968 GAGCCGCGAGACGGGCGCTCAGG - Exonic
1106564739 13:30874390-30874412 GAGGGGCAAGGCTGGGGCTGAGG - Intergenic
1110184493 13:72657118-72657140 AAGCGGCGTGGCTGGTGCTGTGG - Intergenic
1110596627 13:77326952-77326974 TAGCGGCGAGGGCGGCGCGGGGG - Intronic
1113480408 13:110616006-110616028 GAGCGGCGGAGCCCGCGCGGTGG + Intronic
1114269136 14:21090778-21090800 GGGAGGCGAGGCCGGGCCTGGGG - Exonic
1115906690 14:38209473-38209495 GGGCCCCGGGGCCGGCGCTGCGG + Exonic
1117912676 14:60649609-60649631 GAGCGGGGAGGGCGAGGCTGCGG + Intronic
1117954477 14:61111913-61111935 GAGTGGCGAGGCCGGGCCTCCGG + Intergenic
1118257274 14:64215946-64215968 GAGTGGCAAGGCCGGGTCTGGGG - Intronic
1119764842 14:77181850-77181872 GAGCGCCGAGCCTGGGGCTGGGG + Exonic
1120881284 14:89416990-89417012 GCGCGGCGAGCCCGGGGCGGCGG + Intronic
1122221171 14:100239802-100239824 CAGCGGCGGGGCCGGCGCGGCGG + Exonic
1122267814 14:100554853-100554875 GAATGGCGAGGCTGGGGCTGTGG - Intronic
1122409713 14:101519656-101519678 GGGCGGCGAGGGAGGCGCGGAGG + Intergenic
1122459822 14:101885386-101885408 GATGGGAGAGGCCGGGGCTGCGG - Intronic
1122459845 14:101885472-101885494 GATGGGAGAGGCCGGGGCTGTGG - Intronic
1122961106 14:105093920-105093942 GAGAGGCGAGGGCGGAGCCGCGG + Intergenic
1122975308 14:105168477-105168499 GCGCTGGGAGGCCGGCGCGGCGG - Exonic
1123004532 14:105314900-105314922 GAGCGGCGGGGCCGGCGCCATGG + Exonic
1124696821 15:31870538-31870560 TAGCGGCGACTGCGGCGCTGCGG - Intronic
1124966730 15:34437440-34437462 GCGCGGCGAGGACGGCGGCGCGG - Intronic
1124966734 15:34437457-34437479 GCGCGGCGAGGACGGCGGCGCGG - Intronic
1124966738 15:34437474-34437496 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966742 15:34437491-34437513 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966746 15:34437508-34437530 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966750 15:34437525-34437547 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966754 15:34437542-34437564 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966758 15:34437559-34437581 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966762 15:34437576-34437598 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966766 15:34437593-34437615 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966770 15:34437610-34437632 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966774 15:34437627-34437649 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966778 15:34437644-34437666 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966782 15:34437661-34437683 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966786 15:34437678-34437700 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966790 15:34437695-34437717 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1125834456 15:42737161-42737183 GAGGGGCGGGGCCGGCGGCGGGG + Intergenic
1127790142 15:62391641-62391663 GCGCGCCGAGGCAGGCGCGGAGG + Intronic
1128456373 15:67833831-67833853 GTGCGGCCAGGCCGGCCCTAGGG - Exonic
1130305356 15:82709488-82709510 CCGGGGCGGGGCCGGCGCTGGGG + Intronic
1130362919 15:83207551-83207573 AAGCGGCGAGGCGGCGGCTGAGG + Exonic
1132580818 16:683939-683961 GGGCGGCGAGGCTGGCGGTCCGG - Intronic
1132599847 16:768573-768595 GGGCGGCCAGGCCAGGGCTGGGG + Intronic
1132651148 16:1021944-1021966 GAGCAGCTGGGCCCGCGCTGGGG - Intergenic
1132732608 16:1370257-1370279 GAGCGGCGAGGTGGACGCAGAGG + Intronic
1132807552 16:1782164-1782186 CAGCCGCGAGCCCGGCGCAGGGG - Intronic
1132891330 16:2206229-2206251 GGGCGGGCAGGGCGGCGCTGGGG + Intronic
1133020563 16:2965036-2965058 GAGGGGCGGGGCCTGCGCTGGGG + Intronic
1133138191 16:3726519-3726541 TAGCGGAGAGGCTGGGGCTGCGG - Exonic
1133388883 16:5393071-5393093 GAGTGGCGAGGGTGGGGCTGTGG + Intergenic
1134615768 16:15650264-15650286 GGGCGGCGAGGCCAACGCGGCGG - Intronic
1135382692 16:22007993-22008015 GAGCCGGGAGGACGGAGCTGGGG + Intronic
1136413894 16:30092033-30092055 GGGCTGCGAGGCCGGCGGCGCGG + Intergenic
1137387503 16:48055279-48055301 GAGCGGGGAGGGCGGAGGTGGGG - Intergenic
1140396126 16:74628264-74628286 GAGCAGGGAGGCAGGCTCTGTGG + Intronic
1141529099 16:84633884-84633906 GAGTGGAGAGGCAGGCTCTGAGG - Intergenic
1142364359 16:89642078-89642100 GAGCGACGGGGCTGGCTCTGTGG + Intergenic
1142376748 16:89710651-89710673 GAGCGGCAGGGCCGGGGCCGTGG - Exonic
1142764777 17:2058893-2058915 GAGCGGCGGGGGCGGCGCGCAGG + Exonic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1143118413 17:4593220-4593242 GAGAGGGAAGGCCGGGGCTGGGG + Intronic
1144930925 17:18858229-18858251 CTGCGGCGGGGCCGGGGCTGGGG + Exonic
1145765504 17:27456251-27456273 CCGCGGCGAGGCAGGCGGTGAGG - Intergenic
1145800870 17:27683932-27683954 GAGCGGTGAGCCCTGGGCTGGGG - Intergenic
1146053305 17:29568653-29568675 GGGCGGCGCGGGCGGCGCGGGGG + Exonic
1147132841 17:38419214-38419236 GAGGGGCGGGGCCGGCGGGGCGG + Intergenic
1147139716 17:38454145-38454167 GAGCCGCGGGGCCGGGGCCGGGG + Intronic
1147193372 17:38749439-38749461 TAGCGGTGAGGCCGACGCCGGGG + Exonic
1147364854 17:39952977-39952999 GGGCGGTGAGGGCGGGGCTGGGG + Intergenic
1147392979 17:40121822-40121844 GCGAGGGGAGGCCGGGGCTGAGG - Intergenic
1149512734 17:57256574-57256596 GAGCGGCGGAGCCGGGGCAGCGG - Exonic
1151453692 17:74214009-74214031 GAGCGGGCAGGGCGGCGCGGGGG + Intronic
1151824739 17:76517959-76517981 GACCTGAGAGGCCGGGGCTGTGG - Intergenic
1152073437 17:78145257-78145279 GAGCCCCGAGGCCAGGGCTGGGG - Intergenic
1152538822 17:80964709-80964731 TGGCGGAGAGGCAGGCGCTGGGG + Exonic
1152739388 17:82012367-82012389 GAGGGGCCTGGCAGGCGCTGGGG + Intronic
1152942317 17:83179098-83179120 GAGCTGCGAGGAGGCCGCTGCGG + Intergenic
1154070533 18:11148713-11148735 GAGCGTCGCGGCCCGCGCCGAGG - Intronic
1154191068 18:12231514-12231536 GAGAGGTGAGGGCGGCCCTGTGG - Intergenic
1154202333 18:12308179-12308201 GAGCGGCGGGGCGGGGGCGGGGG + Exonic
1154310737 18:13264330-13264352 GAGCAGCAAGGCCTGCTCTGAGG - Intronic
1154333460 18:13448462-13448484 GCGCAGCCAGGCAGGCGCTGGGG - Intronic
1154492509 18:14932623-14932645 GATAGGGGAGGCCGGCGCGGTGG - Intergenic
1158536009 18:58308999-58309021 GAGCGCCGAGGACAGCGCTGAGG - Intronic
1160072841 18:75643457-75643479 GACCAGCGAGGCTGGAGCTGAGG - Intergenic
1160204665 18:76822755-76822777 GAGCGGCGGGGCGGGGGCGGGGG + Intronic
1160575029 18:79848478-79848500 GAGGGGAGAGGCCGACACTGAGG - Intergenic
1160617878 18:80147651-80147673 GAGCGGCCAGGACTGCGCTGTGG + Intergenic
1160935427 19:1592449-1592471 GGGCGCCGAGGCCGCCGCAGAGG + Intronic
1161210363 19:3062430-3062452 GAGCGGGGAGGCGGGCGGCGGGG - Intronic
1161487443 19:4543696-4543718 CAGCGGCGAGGCCCGGCCTGGGG - Exonic
1161779130 19:6279680-6279702 GAGCGGGGAGGCCGGGACCGGGG + Intronic
1161853798 19:6752787-6752809 GAGGGGCGAGGCGGGCGCCTGGG - Intronic
1161864327 19:6822388-6822410 GAGGGGAGAGGCCGGTGTTGGGG - Intronic
1161964696 19:7541545-7541567 GAGTTGGGAGGCCGGGGCTGGGG - Exonic
1162535867 19:11262518-11262540 GCGGGGCGGGGCCGGCGCGGGGG + Intergenic
1162744646 19:12791688-12791710 GAGCGGCGAGCTCTCCGCTGCGG - Exonic
1162959684 19:14118293-14118315 GAGGGGCGCGGCCGGCGCGCGGG + Intergenic
1163544477 19:17933019-17933041 GCGCGACCGGGCCGGCGCTGGGG + Intronic
1165199784 19:34134458-34134480 GAGGGGCGTGGCCGCGGCTGGGG + Intergenic
1165318532 19:35072332-35072354 GAGGGGCAGGGCTGGCGCTGGGG + Intergenic
1165349932 19:35269765-35269787 GAGCGGCGAGGCCGGCGCTGGGG - Intronic
1165862158 19:38914996-38915018 GAGGGGTGAGGCTGGGGCTGGGG + Intergenic
1166094194 19:40529455-40529477 GAGGGGCGGGGCGGGCGGTGGGG + Intronic
1166304101 19:41928011-41928033 GAGCGCCGCGGCCGGCGCAGGGG - Intronic
1166389630 19:42401844-42401866 GAGCGGGGAGACGGGGGCTGCGG - Exonic
1166852551 19:45767523-45767545 GAAGGGAGAGGCCGGCGCTCAGG + Intronic
1167466268 19:49652374-49652396 GGGCGGCGGGGCGGGCGCCGGGG - Exonic
1167613476 19:50518296-50518318 CAGCGGCGGGGGCGGCCCTGGGG - Exonic
1167721366 19:51182608-51182630 CAGCGGGGAGGACGGGGCTGTGG - Intergenic
1167763610 19:51464162-51464184 CAGCGGGGAGGACGGGGCTGTGG + Intergenic
1168110538 19:54189390-54189412 GGGAGGCGTGGCCGGAGCTGCGG - Exonic
1168255164 19:55161040-55161062 GCGCGGCGAGGCTGGGACTGGGG - Intronic
1168594452 19:57664272-57664294 GCGCGGCGATGCCGCAGCTGCGG + Intergenic
925894001 2:8457347-8457369 GAGCGCAGAAGCCGGCGCGGCGG - Intergenic
926095672 2:10079758-10079780 GGGCGGGGAGGCCGGGGCAGCGG + Intronic
926121121 2:10241594-10241616 ATGCGGCGAGGCAGGGGCTGGGG - Intergenic
926130892 2:10302727-10302749 GAGGGCCGAGCCGGGCGCTGAGG + Intergenic
926948587 2:18216505-18216527 GGGAGGCGGGGCGGGCGCTGTGG + Intronic
927111760 2:19868906-19868928 GAGCGCCGAGGCCGGGGCCATGG - Intergenic
931487324 2:62706078-62706100 GAGCGGCGGGGCCGGGGCTCGGG + Intronic
931602595 2:64019220-64019242 CAGCGGCGGAGGCGGCGCTGCGG - Intergenic
932496556 2:72148539-72148561 AGGCGGCGAGGCGGGCGCTGCGG + Intergenic
932791077 2:74654728-74654750 GAGGCGCGAGGCCCGGGCTGGGG - Intronic
934746133 2:96760916-96760938 CAGCGGAGCGGCCGGAGCTGCGG + Exonic
937917777 2:127107279-127107301 GAGGGGCGCGCGCGGCGCTGGGG + Exonic
938099123 2:128486236-128486258 CAGCGCCGAGGCCTGCGCTATGG - Intergenic
945988236 2:216371673-216371695 CAGAGGCGAGGCCGGCGTGGGGG + Exonic
946325406 2:218982289-218982311 GAGCGGGGAGGCGGGAACTGGGG + Intronic
947602679 2:231464268-231464290 GAGGGGCGAGCGCGGCGCCGCGG - Intronic
948805693 2:240452744-240452766 GCGCGGCGGGGCGGGGGCTGCGG + Intronic
948946736 2:241224299-241224321 GAGGAGAGAAGCCGGCGCTGGGG - Exonic
1168854968 20:1002043-1002065 GGGCGGCCGGGCAGGCGCTGCGG - Intronic
1169171802 20:3471217-3471239 GGGCTGGGAGGCCGGGGCTGGGG + Exonic
1170150079 20:13220132-13220154 GAAGGGCTGGGCCGGCGCTGGGG + Intergenic
1171034648 20:21705559-21705581 GGGCGGGGAGGGGGGCGCTGGGG + Intergenic
1171974879 20:31587988-31588010 GCGCGGCGAGTCCAGCGCCGAGG + Intergenic
1172094133 20:32452443-32452465 GAGGGGAGAGGGGGGCGCTGGGG + Intronic
1172149472 20:32780049-32780071 GAGTGGGGAGGCCAGGGCTGGGG - Intronic
1172411809 20:34729926-34729948 GAGAGGTGAGGCTGGAGCTGGGG + Intronic
1172848419 20:37944171-37944193 GGGCGGCGGGGCGGGCGCGGCGG - Exonic
1173576585 20:44116117-44116139 GAACGGCGAGCCCAGCGGTGAGG - Exonic
1174037377 20:47676645-47676667 GAGCTGAGAGGCCGGCCCCGCGG - Intronic
1174317484 20:49713824-49713846 GAGCGGCGAGGCGGCGGCGGCGG - Exonic
1174804609 20:53594225-53594247 GCGCGGCGCGTCCGGCGCTGGGG + Intronic
1175873324 20:62218473-62218495 GAGCGGTGAGTCCTGGGCTGCGG - Exonic
1175878590 20:62243446-62243468 GCGCTGCGGGGCAGGCGCTGCGG - Intronic
1175878595 20:62243460-62243482 GAGCTGCCGGGCAGGCGCTGCGG - Intronic
1175954014 20:62599037-62599059 GAGCGGTGAGGCCTGTGCAGAGG - Intergenic
1176234828 20:64049361-64049383 GGGCGGCGAGGCGGGCGCGGCGG + Exonic
1176234839 20:64049393-64049415 GGGCGGCGGGGCCGGCGGCGAGG + Exonic
1180093105 21:45542590-45542612 GTGGGGAGAGGCCGGCGCCGGGG - Intronic
1180095858 21:45555154-45555176 GGGCGGCGGGGGCGGCGCAGGGG + Intergenic
1180095873 21:45555187-45555209 GGGCGGCGGGGGCGGCGCAGGGG + Intergenic
1180919681 22:19515051-19515073 GAGGGGCCAGGCGGGTGCTGTGG + Intronic
1181458150 22:23070938-23070960 GAGCTGCGGGAGCGGCGCTGAGG + Intronic
1183220148 22:36506958-36506980 AGGCGGGGAGGCCGGAGCTGCGG - Intronic
1183444428 22:37843886-37843908 GAGCGGCGCGAGCGGCGCGGGGG - Intronic
1183535603 22:38398832-38398854 GCGCGGCGCGTCCGGCGCTGGGG + Intergenic
1183650842 22:39152492-39152514 GAGCTGCGGGGCCGCGGCTGCGG + Exonic
1184276370 22:43411673-43411695 GAGGAGCGGGGCCCGCGCTGCGG - Intronic
1184999683 22:48237764-48237786 CAGCAGCTAGGCCTGCGCTGGGG - Intergenic
1185181919 22:49368651-49368673 GAGTGGGGAGGCCAGCGCTGGGG - Intergenic
1185394158 22:50578308-50578330 CAGGGGCGAGGACGGCGCTGGGG - Intronic
950759398 3:15206756-15206778 GAGTGCAGAGGCCGACGCTGAGG + Intronic
954004236 3:47578922-47578944 GTGCGGCGGGGCCGGCGCGGCGG - Exonic
954380304 3:50215705-50215727 GGGCGGGCAGGCAGGCGCTGAGG - Intronic
954382566 3:50227424-50227446 GGGCCGCGAGGCGGGGGCTGGGG + Intronic
957704996 3:83769884-83769906 CAGCAGCGAGGCCGTGGCTGGGG + Intergenic
958692115 3:97481555-97481577 GCGCGGCGCGTCCGGCGCTGGGG + Intronic
962808999 3:138946176-138946198 GTGCGGCGTGGCGGGCGCCGGGG - Exonic
966182326 3:177197920-177197942 GGGCGGGGAGGCCCGCGCGGTGG + Intergenic
966808730 3:183825553-183825575 GAGCGGGGCGGCGGGCGCCGGGG - Exonic
966860924 3:184230505-184230527 GCGCCGGGAGGCCGGCCCTGCGG - Exonic
966911277 3:184561760-184561782 GAGCGGCCGCGCCAGCGCTGGGG + Intronic
968092809 3:195909102-195909124 GCGCGGCGAGGCCCGGGCCGGGG - Intronic
968775447 4:2537008-2537030 CAGCGGCAAGGCCGGCCCGGCGG + Intronic
968803149 4:2756127-2756149 GCGCGGCCAGGCGGGCGCGGAGG + Exonic
968914004 4:3489304-3489326 TTGCAGCGAGGCCGGCCCTGGGG + Intronic
973252245 4:48072629-48072651 GAGAGGCGAGGCCTCTGCTGGGG + Intronic
977908168 4:102501173-102501195 GAGCGGCAAGGCCGGGCCGGGGG + Intergenic
978503446 4:109433492-109433514 CAGCCGCGGGGCCGGCACTGGGG + Intergenic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
979785680 4:124712795-124712817 GAGCGGCGGGGCGGGGGCGGGGG - Intergenic
980541494 4:134201689-134201711 GGGCGGCCAGGCGGGGGCTGGGG + Intronic
982712271 4:158769180-158769202 GAGCGCCACGGCCGGAGCTGCGG + Exonic
983656480 4:170089985-170090007 GCGCGGCGAGGCCCGCGGCGGGG - Intronic
985629608 5:1007853-1007875 GAGCTCCGAGGCTGGCGGTGCGG - Intergenic
985729318 5:1538438-1538460 TGGCGGCGAGGCCGGCTGTGTGG - Intergenic
987118471 5:14744908-14744930 GAGAGGTCAGGCCGGCGGTGGGG + Intronic
989812588 5:45695940-45695962 GGGCGGCGGGGCCGGCGCGAAGG - Exonic
990498230 5:56369767-56369789 GAGGGGCGAGCCCAGAGCTGGGG - Intergenic
990545535 5:56816661-56816683 GAGCCCTGCGGCCGGCGCTGGGG - Intronic
993654354 5:90559001-90559023 GGGCGGCGAGGGCGGCGCGGAGG + Intronic
996398573 5:123036326-123036348 GTGCTGGGAGGCCGGCGCTCCGG - Intronic
997201332 5:132011690-132011712 GCGCGGGGAGGCGGGAGCTGCGG - Intronic
997454004 5:134004559-134004581 GAGCTGAGAGGGAGGCGCTGAGG - Intronic
998374568 5:141682232-141682254 GGGAGGCGGGGCCGGCGCGGCGG - Intergenic
1001496049 5:172188293-172188315 GAGCTGCGAGGCCGGCACAAGGG - Exonic
1001506457 5:172283963-172283985 AGGGGGCGAGGCGGGCGCTGCGG - Exonic
1002368474 5:178730710-178730732 GAGGGGCGGGGCAGCCGCTGAGG + Intergenic
1002524414 5:179807172-179807194 GGGCGGCGGGGGCGGCGCTCCGG + Intronic
1002691351 5:181052921-181052943 GCGGGGCGAGGGCGGCGCTGCGG + Intronic
1002771275 6:292445-292467 GAGCGGCGGGGCGGGCGGGGAGG - Exonic
1002888177 6:1313432-1313454 GCGGGGCGAGGCCGGGGCGGCGG - Exonic
1003624065 6:7726948-7726970 GGGCGGGGATGCCGGGGCTGGGG + Exonic
1005453069 6:25992612-25992634 CAGGGGCAGGGCCGGCGCTGCGG - Intergenic
1007557930 6:42782501-42782523 GGGCGGCGAGGCCGGGCCGGGGG + Intronic
1013792718 6:113855234-113855256 AAGAGGCGGAGCCGGCGCTGGGG - Intergenic
1014001502 6:116370875-116370897 GAGGGACGCGGCGGGCGCTGAGG - Exonic
1014818098 6:125956998-125957020 CGGGGGCCAGGCCGGCGCTGCGG - Exonic
1017017897 6:150116379-150116401 GAGAAGCGAGGCAGGAGCTGGGG - Intergenic
1017877643 6:158537215-158537237 GGGCGGCGAGGCGGGCGCGGGGG - Intronic
1017983501 6:159422737-159422759 GAGGGCCGAGGACGGGGCTGTGG - Intergenic
1019298927 7:293620-293642 GAGAGGCAAGGGCGGCACTGGGG + Intergenic
1020201180 7:6081391-6081413 AGGCGGCGGGGCCGGGGCTGTGG - Intergenic
1020238469 7:6374470-6374492 GAGCGGCGGCGCCGGCGCGGGGG + Intergenic
1020395808 7:7716656-7716678 GGCCGGCGCGGCCGGCGCGGTGG + Intronic
1022098587 7:27156099-27156121 GAGCGGGGAGCGCAGCGCTGGGG - Intronic
1022207927 7:28180702-28180724 GAGCGGCGAGGACGGGACGGAGG + Exonic
1026822215 7:73557385-73557407 GAGCCGACCGGCCGGCGCTGGGG - Intronic
1026840433 7:73667776-73667798 GAGCCGCGGCGCCGGGGCTGGGG - Intergenic
1027956039 7:84880674-84880696 GAGCGGCCAGCCCGCCGCCGCGG + Intergenic
1029452025 7:100646728-100646750 GTGAGGCCAGGCCGGAGCTGAGG - Intronic
1032080191 7:128854791-128854813 GACCCGGGAGGCTGGCGCTGGGG + Exonic
1032193452 7:129777362-129777384 GAGGGGTGAGGCAGGCGCAGGGG - Intergenic
1033390722 7:140924831-140924853 GAGCGGCCCGGGCGGCGCCGCGG + Intergenic
1033732818 7:144195614-144195636 GGGCGGCCGGGCCTGCGCTGGGG - Exonic
1033743669 7:144294194-144294216 GGGCGGCCGGGCCTGCGCTGGGG - Intergenic
1033750233 7:144355403-144355425 GGGCGGCCGGGCCTGCGCTGGGG + Exonic
1034447938 7:151122952-151122974 GAGCGCCGGAGCCCGCGCTGGGG + Intronic
1034787193 7:153936349-153936371 GAGCGGCCAGGATGGGGCTGGGG + Intronic
1035717065 8:1763378-1763400 GCGCGGCGCGGCGGGCGCTGTGG - Intronic
1036788368 8:11702579-11702601 GATCTCGGAGGCCGGCGCTGCGG - Intronic
1037644068 8:20774339-20774361 CAGCGGGGAGGCCAGCACTGTGG - Intergenic
1037769163 8:21788988-21789010 GAGCGCCGAGCCCGGGGCGGAGG - Intronic
1038035392 8:23682579-23682601 AAGCGGCGAGGCCGGGGAAGGGG - Intronic
1045492786 8:102682890-102682912 GAGAGGAGAGGCCAGCGCTGTGG + Intergenic
1047024528 8:120811678-120811700 GAGCAGCGAGGAGGGCGCTGCGG - Exonic
1049828565 8:144685618-144685640 TGGCGGAGGGGCCGGCGCTGCGG - Intergenic
1053163563 9:35829500-35829522 GCGGGGCGAGGGCGGGGCTGGGG - Exonic
1056532174 9:87497741-87497763 GCCCTGCCAGGCCGGCGCTGCGG - Intronic
1058439088 9:104991222-104991244 GGCGGGCGGGGCCGGCGCTGGGG - Intergenic
1059375198 9:113876085-113876107 GCACGGCGAGGCCGGCCCGGGGG + Intergenic
1060283475 9:122228846-122228868 GGGCGGCGGGGCCGGCGCCTCGG - Intronic
1060784639 9:126440997-126441019 ATGCGGCGAGGCCTGGGCTGAGG + Intronic
1061112104 9:128580944-128580966 GAGCGGCGCTGCTGGAGCTGTGG + Exonic
1061559588 9:131394079-131394101 GAGCGGCGAGACAGGCGCCGAGG + Intronic
1061880994 9:133568754-133568776 GACCGGTGAGGCCTGCACTGAGG + Exonic
1062529065 9:136992071-136992093 GACCGGCGAGGCCAGCGCTGGGG + Intergenic
1062540913 9:137041237-137041259 AAGCGGGGAGGCCGGGCCTGGGG - Intronic
1062614821 9:137391547-137391569 GGGCGGGGAGGCCGGCCCTCTGG - Intronic
1062696347 9:137877999-137878021 GGGCGGCGGGGCCGGCGGGGCGG + Exonic
1186660558 X:11664666-11664688 GAGCGACGAGGCGGGCGCGGAGG - Exonic
1187419545 X:19122534-19122556 GAGCGGCGGGGGCGGCGCCGAGG - Exonic
1187507284 X:19887784-19887806 GAGGGGCGGGGCCGGGGCCGGGG + Intergenic
1190062260 X:47219058-47219080 GAGCCGCGGGGCCGGCGCGGCGG - Intronic
1192224195 X:69217241-69217263 GAGCAGAGAGGCCTGCTCTGGGG - Intergenic
1194977573 X:100409636-100409658 GAGAGGCGGGGCCGCCGCCGTGG + Exonic
1198215268 X:134549629-134549651 GAGCGGCGCAGCCGGCGGAGAGG + Intergenic