ID: 1165354331

View in Genome Browser
Species Human (GRCh38)
Location 19:35294210-35294232
Sequence GCATGCAACAAGAGTCACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 90}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165354331_1165354336 1 Left 1165354331 19:35294210-35294232 CCTGAGTGACTCTTGTTGCATGC 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1165354336 19:35294234-35294256 GGTTGTCTGGCGGCTTCAGGTGG 0: 1
1: 0
2: 0
3: 7
4: 112
1165354331_1165354334 -9 Left 1165354331 19:35294210-35294232 CCTGAGTGACTCTTGTTGCATGC 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1165354334 19:35294224-35294246 GTTGCATGCAGGTTGTCTGGCGG 0: 1
1: 0
2: 0
3: 11
4: 158
1165354331_1165354339 26 Left 1165354331 19:35294210-35294232 CCTGAGTGACTCTTGTTGCATGC 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1165354339 19:35294259-35294281 CCAGAAGACGTCCCCAACTCAGG 0: 1
1: 0
2: 0
3: 5
4: 68
1165354331_1165354335 -2 Left 1165354331 19:35294210-35294232 CCTGAGTGACTCTTGTTGCATGC 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1165354335 19:35294231-35294253 GCAGGTTGTCTGGCGGCTTCAGG 0: 1
1: 0
2: 1
3: 3
4: 117
1165354331_1165354340 27 Left 1165354331 19:35294210-35294232 CCTGAGTGACTCTTGTTGCATGC 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1165354340 19:35294260-35294282 CAGAAGACGTCCCCAACTCAGGG 0: 1
1: 0
2: 1
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165354331 Original CRISPR GCATGCAACAAGAGTCACTC AGG (reversed) Intronic
905200890 1:36315981-36316003 GCATGCAACAAAGGACAATCAGG - Intronic
907566874 1:55443668-55443690 GCTTGCAGCAAGAGTCATCCTGG - Intergenic
909345138 1:74576355-74576377 GCATTCAACTAGAGGAACTCAGG - Intronic
920868710 1:209775183-209775205 GCTAGCAAGAAGAGTCCCTCAGG - Intronic
1071034300 10:81224455-81224477 GCATTTTACAGGAGTCACTCTGG + Intergenic
1074280939 10:112050941-112050963 GCATGCAACAACAGCCACCCAGG + Intergenic
1074738599 10:116462106-116462128 ACTTGTAACAAGAATCACTCTGG + Intronic
1076018305 10:127046984-127047006 GCATCCAACAAAATTCACTGAGG - Intronic
1079522951 11:21350555-21350577 ACCTGCCAGAAGAGTCACTCAGG - Intronic
1080801476 11:35614114-35614136 GCATTTAACAAGAGTTACACTGG + Intergenic
1093743601 12:22715080-22715102 GCATGCGACAAAAATAACTCTGG - Intergenic
1093921291 12:24862564-24862586 GCATGCATCACAAGTCACTTTGG - Intronic
1094476361 12:30843659-30843681 CCATCCACCCAGAGTCACTCAGG - Intergenic
1094871289 12:34600549-34600571 TCATGCACCAAGAGTGTCTCAGG + Intergenic
1100442296 12:94628158-94628180 GTATGGAAAAGGAGTCACTCGGG - Intronic
1100885043 12:99060427-99060449 GCATAAAATAAGAGTTACTCTGG - Intronic
1101805565 12:108060713-108060735 GCATCAAACAAGAATCACTTGGG + Intergenic
1106200094 13:27528735-27528757 CCATGCAAGAAGAGTCTCTCCGG + Intergenic
1106818951 13:33441677-33441699 GTATTCTACAAGAGTCAGTCAGG + Intergenic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1116343855 14:43762455-43762477 GCATAGAACAAGAGACACTGGGG + Intergenic
1124625369 15:31304547-31304569 GCATGAAGCCAGCGTCACTCTGG - Intergenic
1132426073 15:101718367-101718389 GAAAGCAACAAGAGTTACCCAGG - Intronic
1132558892 16:584604-584626 CCAGGCAACCAGAGGCACTCAGG + Intergenic
1133143037 16:3762274-3762296 GCCTGAAACAAGTGTCACTTTGG + Intronic
1135129221 16:19838484-19838506 GCATTCAGAAAGAGTCATTCTGG - Intronic
1136025896 16:27469025-27469047 GCAGGCACCAGCAGTCACTCAGG - Intronic
1139677116 16:68531304-68531326 GACGGCAACAAGAGTGACTCTGG - Intronic
1141996953 16:87641822-87641844 GCCTGCAACACAAGTCCCTCTGG + Intronic
1142741725 17:1935459-1935481 GGAGGCAGCAAGAGTCACTTTGG - Exonic
1146910042 17:36642407-36642429 GCATGCAACATCACTCAGTCGGG - Intergenic
1163873110 19:19841650-19841672 GTATGCACCGTGAGTCACTCAGG - Intergenic
1163954089 19:20618417-20618439 GTATGCACCCTGAGTCACTCAGG + Intronic
1163961622 19:20701155-20701177 GTATGCACCCTGAGTCACTCAGG - Intronic
1165354331 19:35294210-35294232 GCATGCAACAAGAGTCACTCAGG - Intronic
1168549674 19:57282352-57282374 GCAAGCAACAAGAGTCATAGAGG - Intronic
1168553891 19:57322106-57322128 GCAAGGAACAAGAGTCACAGAGG - Intronic
925860641 2:8172337-8172359 GCATGCAACTCGTGTGACTCCGG - Intergenic
929815872 2:45230971-45230993 GAATGCATCAAGAGACACACAGG - Intergenic
930280677 2:49365822-49365844 GCATGTTACAAAAGTCACTTGGG + Intergenic
931095073 2:58930714-58930736 GCAAGGAACAAGAGTGACCCAGG + Intergenic
931990410 2:67784395-67784417 GTGTGCCACAAGCGTCACTCTGG - Intergenic
937525748 2:122767548-122767570 GATGGCAACAACAGTCACTCGGG + Intergenic
938174074 2:129108148-129108170 GCATCCCAAAGGAGTCACTCTGG + Intergenic
941818825 2:169825188-169825210 GGAAACAAGAAGAGTCACTCTGG - Intergenic
948154073 2:235767275-235767297 GAATGCACCAAGAGTTTCTCTGG + Intronic
948840055 2:240644456-240644478 GCAGCCAGCAAGAGTCCCTCGGG - Intergenic
1168980228 20:1997602-1997624 GCAGGCAACATGGATCACTCAGG + Intergenic
1169431199 20:5538048-5538070 GAATGGCACATGAGTCACTCTGG - Intergenic
1170350819 20:15439134-15439156 CCATGGAACAATGGTCACTCAGG + Intronic
1170417141 20:16156684-16156706 GCATGTAACAAGTGCCACACAGG + Intergenic
1181372113 22:22426986-22427008 CCATGGACCAAGACTCACTCTGG + Intergenic
1181626286 22:24124402-24124424 GCAGGCAACAAAGGTCTCTCAGG - Intronic
1181969658 22:26680619-26680641 GAATGAAACAAGAGTCAGTTGGG + Intergenic
1184833564 22:47006924-47006946 GCATGAAACAAGTGTCACACAGG + Intronic
951283963 3:20786873-20786895 GCCTGCAACATGAGCGACTCAGG - Intergenic
954072798 3:48155271-48155293 GCATGAATCAATAGTGACTCAGG - Intergenic
954697054 3:52433207-52433229 TCATGAAACAGAAGTCACTCAGG + Exonic
954972235 3:54660995-54661017 GCAGGCAGCAGGATTCACTCTGG - Intronic
966144549 3:176794929-176794951 GCTTGCAGCCAGTGTCACTCAGG - Intergenic
968927573 4:3557820-3557842 ACATGCAAACAGAGTCACACTGG - Intergenic
970012725 4:11477942-11477964 GAATGGAACAAGAGACACTAGGG + Intergenic
973530216 4:51830258-51830280 GCACACAACAAAAGTGACTCTGG + Intergenic
973617963 4:52698703-52698725 GCACGGAACAAGAGACACTGGGG + Intergenic
980017345 4:127666201-127666223 GCAAGCAACAAGAGACGATCGGG - Intronic
981955143 4:150463186-150463208 GAATGCTACAAAAGTCATTCAGG - Intronic
983030512 4:162795870-162795892 GCCTTCAACTAGAGTCACTGAGG + Intergenic
986950087 5:13072562-13072584 TCATGGAAATAGAGTCACTCTGG - Intergenic
998412794 5:141923984-141924006 CCAAGCAACCAGCGTCACTCTGG + Intronic
1010126037 6:72432890-72432912 CCAAGCTACAAGAGTCATTCTGG - Intergenic
1016187593 6:141216805-141216827 GCATGAGACAAGAGTCTCACAGG + Intergenic
1022977593 7:35573529-35573551 GCATGCAAGAAGACTTATTCAGG + Intergenic
1028480010 7:91293992-91294014 GCAGGCAACACGCTTCACTCAGG - Intergenic
1030242420 7:107343187-107343209 GATGGCAACAAGAGACACTCGGG + Intronic
1034373383 7:150621510-150621532 TCAGCCAACAAGAGGCACTCAGG + Intergenic
1035843670 8:2840184-2840206 CCATGAAACATGAGTCACTTTGG - Intergenic
1042861772 8:73321551-73321573 GTATGTAACTAGATTCACTCTGG + Intronic
1043867489 8:85392625-85392647 GGAGGTAACAAGAGTCAGTCTGG + Intronic
1045937732 8:107701360-107701382 ACATGCAAGAAAAGACACTCAGG + Intergenic
1046853709 8:119005339-119005361 GAATTCAACAAGCTTCACTCAGG + Intronic
1048965469 8:139611499-139611521 ACATGCACCATGAGTGACTCAGG - Intronic
1052929769 9:34046841-34046863 CCATACAATAAAAGTCACTCAGG + Intronic
1053802430 9:41772899-41772921 ACATGCAAACAGAGTCACGCTGG - Intergenic
1054462554 9:65473321-65473343 ACATGCAAACAGAGTCACGCTGG + Intergenic
1054647635 9:67603472-67603494 ACATGCAAACAGAGTCACGCTGG + Intergenic
1054647649 9:67603562-67603584 GCATGCAAACAGGGTCACGCTGG + Intergenic
1057351634 9:94303620-94303642 GTATGCAAAAACAGTCACACTGG + Intergenic
1187755250 X:22518160-22518182 TCATTGAACAAGAGGCACTCAGG + Intergenic
1189907408 X:45775703-45775725 GCATGCAACAACACGCCCTCAGG + Intergenic
1193792182 X:85828242-85828264 GAATGGAACAACAGTCACTGGGG + Intergenic
1195397216 X:104424676-104424698 CCATGCCAAAAGAGTTACTCTGG - Intergenic
1197771060 X:130089685-130089707 GCAAGGAAGAAGAGTCACTTGGG - Intronic
1200971865 Y:9161299-9161321 ACATGCAACAAGAGAGATTCAGG + Intergenic
1202139162 Y:21702994-21703016 ACATGCAACAAGAGAGATTCAGG - Intergenic