ID: 1165355291

View in Genome Browser
Species Human (GRCh38)
Location 19:35300235-35300257
Sequence GCATCCAGGTCAGCAGCGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 195}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165355291_1165355303 7 Left 1165355291 19:35300235-35300257 CCCGCCGCTGCTGACCTGGATGC 0: 1
1: 0
2: 2
3: 24
4: 195
Right 1165355303 19:35300265-35300287 GACAGTCCTCCGGGAGGCGGTGG 0: 1
1: 0
2: 1
3: 19
4: 208
1165355291_1165355301 1 Left 1165355291 19:35300235-35300257 CCCGCCGCTGCTGACCTGGATGC 0: 1
1: 0
2: 2
3: 24
4: 195
Right 1165355301 19:35300259-35300281 GGACGGGACAGTCCTCCGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 87
1165355291_1165355300 -2 Left 1165355291 19:35300235-35300257 CCCGCCGCTGCTGACCTGGATGC 0: 1
1: 0
2: 2
3: 24
4: 195
Right 1165355300 19:35300256-35300278 GCGGGACGGGACAGTCCTCCGGG 0: 1
1: 0
2: 1
3: 8
4: 92
1165355291_1165355306 25 Left 1165355291 19:35300235-35300257 CCCGCCGCTGCTGACCTGGATGC 0: 1
1: 0
2: 2
3: 24
4: 195
Right 1165355306 19:35300283-35300305 GGTGGCCGAGAGCCTGCTCCTGG 0: 1
1: 0
2: 1
3: 17
4: 236
1165355291_1165355299 -3 Left 1165355291 19:35300235-35300257 CCCGCCGCTGCTGACCTGGATGC 0: 1
1: 0
2: 2
3: 24
4: 195
Right 1165355299 19:35300255-35300277 TGCGGGACGGGACAGTCCTCCGG 0: 1
1: 0
2: 1
3: 5
4: 78
1165355291_1165355302 4 Left 1165355291 19:35300235-35300257 CCCGCCGCTGCTGACCTGGATGC 0: 1
1: 0
2: 2
3: 24
4: 195
Right 1165355302 19:35300262-35300284 CGGGACAGTCCTCCGGGAGGCGG 0: 1
1: 0
2: 0
3: 13
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165355291 Original CRISPR GCATCCAGGTCAGCAGCGGC GGG (reversed) Exonic
900224637 1:1527231-1527253 GCTCCCAGGTCAGCTGCTGCCGG + Intronic
900234175 1:1578798-1578820 CCTTCCAGGTGAGGAGCGGCAGG - Intergenic
900540488 1:3200232-3200254 CCATCCAGGGCAGCCTCGGCCGG - Intronic
900739053 1:4319424-4319446 GCATCCTGGTGATCAGGGGCGGG - Intergenic
901525956 1:9823673-9823695 GCAGCCCGGCCAGCAGCAGCCGG + Exonic
901932900 1:12608336-12608358 GCATCCAGTTCAGAAGCCACAGG + Intronic
902166490 1:14576033-14576055 GCATCCAGGTTAGGAGTGGTAGG + Intergenic
904490852 1:30858208-30858230 CCAGCCAGGACAGCAGAGGCGGG - Intergenic
906642918 1:47452291-47452313 GTGTCCAGGACAGCAGTGGCTGG + Intergenic
907386064 1:54125956-54125978 GTGTCCAGGTCAGCAGGGCCTGG + Intergenic
907438590 1:54464740-54464762 GAAGCTAGGTCAGCAGGGGCTGG + Intergenic
910803168 1:91165186-91165208 GCAGCCAGGTCAGCCCCAGCTGG + Intergenic
911205654 1:95089673-95089695 GCATGCAGGTGAGCAGGTGCAGG + Intergenic
912793278 1:112674442-112674464 GGATCTAGGTCGGCTGCGGCCGG - Exonic
915893574 1:159793569-159793591 AGATCTAGGGCAGCAGCGGCAGG - Intergenic
918071085 1:181133799-181133821 CCATCCAGGCCAGGAGCCGCAGG - Intergenic
920564265 1:206960998-206961020 GCAACCAGGCCAGCAGCTCCAGG - Exonic
921404500 1:214764620-214764642 GCATGCTGGTCAGCTGTGGCAGG + Intergenic
923701172 1:236301723-236301745 GCATGCAGGTGAGCAGGTGCTGG - Intergenic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
1067546585 10:47196496-47196518 GCTCCCAGGACAGCAGAGGCAGG - Intergenic
1069666828 10:70168157-70168179 GCATACAAATCAGCAGCAGCCGG - Intronic
1069760664 10:70809002-70809024 GCATGCAGGTCAGTAGGGGCAGG - Intergenic
1069909105 10:71749109-71749131 GCCTCAAGGTCAGCAGCTGAGGG + Exonic
1070551254 10:77492317-77492339 GCATGCAGATCAGCAGGGGCTGG - Intronic
1071960439 10:90804513-90804535 GCATGCAGGTGAGCAGGTGCAGG - Intronic
1072211231 10:93248828-93248850 GGATCCAGGTTAGCAGAGGCCGG + Intergenic
1073181238 10:101584780-101584802 TTATCCAGGACAGCAGGGGCTGG + Exonic
1076136311 10:128047412-128047434 GCAGCCAGGCCAGCAGCGGCTGG - Exonic
1077210710 11:1369878-1369900 GAACCCAGGTCAGCAGGGGATGG + Intergenic
1077372288 11:2188754-2188776 GTATCCAGGACAGCAGCCGCAGG + Intergenic
1077410084 11:2399880-2399902 GCTTCCAAGTCAGCCGTGGCTGG - Intergenic
1077891113 11:6418924-6418946 GCGTCCCGATCACCAGCGGCCGG - Intronic
1081255798 11:40892759-40892781 GAATACAGGTTACCAGCGGCTGG + Intronic
1081811053 11:45914310-45914332 GGATACAGTGCAGCAGCGGCCGG + Exonic
1082996719 11:59261289-59261311 CCAGCCAGGTGAGCAGAGGCTGG - Intergenic
1082997138 11:59263385-59263407 CCAGCCAGGTGAGCAGGGGCTGG - Intergenic
1083622380 11:64055594-64055616 GCAGCCAGCCCAGCAGAGGCAGG + Intronic
1083996720 11:66276628-66276650 GCAGCCAGGGCAGTAGAGGCCGG - Exonic
1084596671 11:70120725-70120747 GCATCCATGTCACCAAGGGCCGG + Intronic
1085328093 11:75623998-75624020 GCAGCCAGGCCAGCAGCGGGTGG + Intronic
1085438071 11:76528355-76528377 GCATCCAGGGTAGCAGAGGCTGG + Exonic
1085796040 11:79540865-79540887 TCTTCCAGGTGAGCAGCAGCTGG + Intergenic
1089560661 11:119341564-119341586 GCTTCCAGGTCAGCTGCCTCTGG + Exonic
1091585894 12:1816456-1816478 GGACCCAGGTCAGCTGGGGCAGG - Intronic
1093044258 12:14424315-14424337 GCATCCAGATCACCAGGGGCTGG - Exonic
1097146073 12:56940168-56940190 GACTCCAGGCCAGCAGGGGCAGG + Intergenic
1097151790 12:56984645-56984667 GACTCCAGGCCAGCAGGGGCAGG + Intergenic
1099478670 12:83140255-83140277 GCACCCGGGCCAGCAGCTGCGGG + Intergenic
1101897017 12:108764601-108764623 TCATCCAGGCCAGCAGGGTCTGG - Intergenic
1104760282 12:131293994-131294016 CCATCCAGGGCTGCAGGGGCTGG - Intergenic
1105541647 13:21321351-21321373 GAGTCCAGGGCAGCAGGGGCAGG - Intergenic
1105846476 13:24298428-24298450 ACCTCCAGGTCAGCAGAAGCTGG - Intronic
1106789249 13:33137986-33138008 GCATCCAGGCCAGGAGGTGCTGG + Intronic
1109693714 13:65926896-65926918 GCATGCAGGTGAGCAGGTGCAGG + Intergenic
1109956900 13:69580647-69580669 GAATCCTGCTCAGCAGCTGCAGG + Intergenic
1113529013 13:111006272-111006294 GCTTCCGGGGCAGCAGCTGCAGG + Intergenic
1115888788 14:38004139-38004161 GCTTCAAGGGCAGCAGGGGCAGG + Intronic
1121241906 14:92436965-92436987 GCATCCAGGGCATCTGAGGCAGG - Intronic
1121631190 14:95422946-95422968 ACATCCAAGTCAGAAGTGGCAGG - Intronic
1122641759 14:103164173-103164195 GCATGCAGGTGAGCAGGTGCAGG - Intergenic
1125158240 15:36614171-36614193 TCATTCAGGTCAGCAGAGTCTGG - Intronic
1126212165 15:46111863-46111885 GCATGCAGGTGAGCAGGTGCAGG - Intergenic
1127966891 15:63929330-63929352 GCATCCAGGGGAGCAGCCTCAGG - Intronic
1129231320 15:74198740-74198762 GCATTCAGCTCAGCAGGTGCTGG - Intronic
1129431962 15:75505632-75505654 GCATCCTGGTAACCAGCTGCTGG + Intronic
1130150693 15:81309330-81309352 GCATTCAGGCCAGCAGCCCCAGG - Exonic
1131058923 15:89392492-89392514 GCATCCAGCTCAGCAGAACCGGG + Intergenic
1131403326 15:92143956-92143978 GCAGCCAGGTCACCAGAGGTGGG + Intronic
1132007565 15:98243098-98243120 GCATCCGGGTCAGGGGCGGGTGG + Intergenic
1132328082 15:100988647-100988669 GCATCCAGTTCAGAAGCCGCTGG - Exonic
1133255734 16:4514616-4514638 CCATCCAGGCCAGCAGCTGAAGG - Exonic
1135480016 16:22814449-22814471 GCACCCTGGTCAGCAGCCCCCGG + Exonic
1136520369 16:30791875-30791897 GCACACAGGTCACCAGTGGCAGG + Intergenic
1137546203 16:49405346-49405368 GCATTCAGCTCAGCTGGGGCTGG - Intergenic
1140805670 16:78530080-78530102 GCATGCAGGTGAGCAGGTGCAGG + Intronic
1141619321 16:85228442-85228464 GCTTCCAGGTCAGCTGTGCCTGG + Intergenic
1142198394 16:88749411-88749433 GGAACCAGGGCAGCAGCAGCAGG + Exonic
1144596099 17:16571422-16571444 GCATCCATCCCAGCAGCTGCCGG + Intergenic
1145108546 17:20141082-20141104 CCATCAAGGTCTGCAGTGGCAGG - Intronic
1147333862 17:39715375-39715397 GCATCCTGTTCTGCAGGGGCTGG + Intronic
1148088707 17:45009782-45009804 GCCTCCTGGTCAGCAGCTGTAGG + Intergenic
1148291095 17:46450590-46450612 GATTCCAGGTCATCAGCTGCTGG - Intergenic
1148313283 17:46668293-46668315 GATTCCAGGTCATCAGCTGCTGG - Intronic
1148693494 17:49545954-49545976 GCCTCCATGGCAGCAGCAGCTGG - Intergenic
1148897549 17:50848248-50848270 GCCTGCAGGTCAGCACAGGCTGG - Intergenic
1149722813 17:58863333-58863355 GCATGCAGGTGAGCAGTTGCAGG + Intronic
1151617773 17:75225517-75225539 GCATCCAGTGCAGCAGTGGCAGG + Intronic
1156311583 18:35927183-35927205 GCATGCAGGTGAGCAGGTGCAGG - Intergenic
1156381335 18:36564135-36564157 GCAGCAGGGTCAGCAGTGGCTGG - Intronic
1156684349 18:39626945-39626967 GCATGCAGGTGAGCAGGTGCAGG + Intergenic
1158293748 18:55971220-55971242 GCAGCAAGGACAGCAGCAGCAGG - Intergenic
1160008925 18:75089081-75089103 ACAACCAGGTCCACAGCGGCAGG + Intergenic
1160156288 18:76436307-76436329 GCATCCAGTTCAGCTGGGGAAGG - Intronic
1161302137 19:3547877-3547899 GCTTCCAGAGCAGCAGGGGCTGG + Exonic
1164919583 19:32078928-32078950 GCATCCAGCACAGCAGGGCCAGG + Intergenic
1165062216 19:33210493-33210515 GCCTCCAGCGCAGCAGCAGCAGG + Exonic
1165148271 19:33745919-33745941 GGAGCCAGGACAGCAGGGGCTGG - Intronic
1165355291 19:35300235-35300257 GCATCCAGGTCAGCAGCGGCGGG - Exonic
1166231059 19:41426082-41426104 CCAGCCAGGCCAGCAGCAGCAGG + Exonic
1167009289 19:46796273-46796295 GCAGCCCGGTCACCAGCTGCTGG - Intergenic
926973676 2:18491857-18491879 TCACCCAGGTCAGCAGCTGCAGG - Intergenic
928036884 2:27832732-27832754 GGATCCAGGTCAGCAATGGCAGG + Exonic
930527002 2:52542785-52542807 GCTACCAGCTCAGCCGCGGCAGG + Intergenic
930527328 2:52546041-52546063 GCATGCAGGTGAGCAGGTGCAGG - Intergenic
936007858 2:108906430-108906452 TCCTCCATGTCAGCAGGGGCAGG + Intronic
937256854 2:120561693-120561715 TCATCCAGGCCAGCGGCCGCAGG - Intergenic
937656167 2:124379354-124379376 GCAAAAAGGTCAGCAGCTGCTGG - Intronic
938150642 2:128879583-128879605 GCATGCAGGTGAGCAGGTGCAGG + Intergenic
942122497 2:172792204-172792226 GCAGCAAGGACAGCAGCAGCTGG - Intronic
944512275 2:200476568-200476590 GCATGCAGGTGAGCAGGTGCAGG + Intronic
945302566 2:208227908-208227930 GCACCCAGGCCAGCAGCTGCTGG - Intergenic
945868560 2:215202945-215202967 GCATGCAGGTGAGCAGGTGCAGG + Intergenic
946229476 2:218282618-218282640 GCATCCCCGTCAGCTGTGGCAGG - Intronic
947759797 2:232595639-232595661 GTGGCCAGGTCAGCAGCGACAGG + Intergenic
948938236 2:241182379-241182401 ACATTCAGGTCAGCAGAGGAAGG - Intronic
949075720 2:242056277-242056299 GCCTCCAGGTCTGCAGAGCCTGG + Intergenic
1170969559 20:21104551-21104573 GCAACCAGGTCTGCAGCCGCTGG + Intergenic
1171290925 20:23982424-23982446 GCTTCCAGGACTGCAGCGGGTGG - Intergenic
1174782152 20:53399716-53399738 GCAGCCAGGTCAGCAGCGACTGG - Intronic
1175795739 20:61769603-61769625 GCAGCCCGTTCAGCAGAGGCAGG - Intronic
1176056194 20:63150549-63150571 CCACCCAGGTCAGCAGGGGCTGG + Intergenic
1176148182 20:63574577-63574599 GCTTCCAGGTCAGCTGTGCCTGG - Intergenic
1177147612 21:17423341-17423363 GCATCCAGGTAAGCTGCAGCTGG + Intergenic
1179568709 21:42265222-42265244 GCATCCAGTGCAGCAGCCCCGGG + Intronic
1179809538 21:43861654-43861676 GCACACAGGGCAGCAGAGGCAGG - Intergenic
1179983984 21:44911012-44911034 GCACCCAGGACAGCTGCAGCGGG + Intronic
1180061350 21:45386550-45386572 GCTTCCAGGCAGGCAGCGGCTGG + Intergenic
1180779825 22:18513736-18513758 GCTTCCAGGACTGCAGCGGGTGG - Intergenic
1180925060 22:19548042-19548064 GCATTCAGGGAAGCAGAGGCAGG - Intergenic
1181198697 22:21205304-21205326 GCTTCCAGGACTGCAGCGGGTGG - Intergenic
1181648480 22:24246387-24246409 GCTTCCAGGACTGCAGCGGGTGG - Intergenic
1181703012 22:24631575-24631597 GCTTCCAGGACTGCAGCGGGTGG + Intergenic
1181851552 22:25753213-25753235 GCCTCCCGGTCGGCAGGGGCGGG + Intronic
1182461351 22:30486001-30486023 GTACCCAGGTCAGCTGCCGCTGG - Intergenic
1182900425 22:33894021-33894043 GCATCCAGGTCTGCAGGGCCGGG - Intronic
1184730447 22:46368579-46368601 GCTACCAGGTCACCAGGGGCTGG + Intronic
1184986937 22:48142193-48142215 GCCTGCAGGTCAGGAGGGGCTGG + Intergenic
1203228108 22_KI270731v1_random:89533-89555 GCTTCCAGGACTGCAGCGGGTGG + Intergenic
949670329 3:6392562-6392584 GCATCTAGGAGAGCAGTGGCTGG - Intergenic
949841710 3:8327238-8327260 GCCTCCAGGTCAACAGAGGTAGG - Intergenic
950497152 3:13340642-13340664 GCAGCAATGTCAGCAGCGCCTGG + Intronic
952039165 3:29241050-29241072 GCATGCAGGTCAGCAGGTGCTGG + Intergenic
952773846 3:37025901-37025923 GCAGCCACTTCAGCAGGGGCTGG - Exonic
956674852 3:71724669-71724691 GAGTCCACGGCAGCAGCGGCCGG + Intronic
961328559 3:126125876-126125898 GCATCCAGGACAGAAACAGCAGG - Intronic
964306217 3:155343046-155343068 GCATCCAGGTGTGAAGCGGGGGG + Intergenic
967191739 3:186990858-186990880 GCATCTAGGTCAGCTGCTCCTGG - Intronic
967951547 3:194844997-194845019 GCCTCCAGATTAGCAGAGGCTGG - Intergenic
968488602 4:877389-877411 GGATCCTGGTCAGCAGCAGGAGG - Intronic
968488613 4:877448-877470 GGATCCTGGTCAGCAGCAGGAGG - Intronic
968578609 4:1379338-1379360 GCATCCAGGTGGGCAGGGGGTGG + Intronic
968583697 4:1406333-1406355 GCTTCCTGGGCAGCGGCGGCGGG + Intergenic
969343223 4:6555563-6555585 GCAGCCAGGCCTGCAGCCGCAGG + Intronic
969657705 4:8507684-8507706 GCCTCCAGGTGACCAGGGGCAGG - Intergenic
971267442 4:25107857-25107879 GCAGCCAGGACAGCAGAGGCGGG - Intergenic
971761284 4:30769262-30769284 GCAGCCAAGTCAGCAGGAGCTGG - Intronic
973275190 4:48299668-48299690 GCAAACAGGTCAGCAGCGGATGG + Intergenic
973292530 4:48484008-48484030 GCAGGAAGGCCAGCAGCGGCAGG - Exonic
982256225 4:153453906-153453928 GCTACCAGGTCAGCAGTGGGAGG - Intergenic
985272975 4:188211536-188211558 GAATGCAGGTCACCAGGGGCTGG - Intergenic
985541876 5:491199-491221 GCATCCCCGGCAGCAGCGGCGGG + Intronic
986588757 5:9346603-9346625 GCATACAGGTGAGCAGATGCAGG - Intronic
988796274 5:34656235-34656257 GGATCCAGGTCGGCGGGGGCCGG + Intronic
991085787 5:62647270-62647292 GCATCTTGGTGAGCAGAGGCAGG - Intergenic
992143309 5:73820649-73820671 GCATCTAGGTCAGCAGCCAGGGG - Intronic
992231253 5:74666520-74666542 GGATCAAGTTCAGCAGGGGCAGG + Intronic
997266170 5:132496503-132496525 GCAGCCGGGTCAGCAGCTACAGG + Intergenic
997935900 5:138110706-138110728 GCGTCCTGGGCAGCAGCTGCAGG - Intergenic
999737434 5:154523216-154523238 GCAACCAGCTCAGCAGAGCCAGG + Intergenic
1002928606 6:1619133-1619155 ACACCCAGGACAGCAGCGGCTGG + Intergenic
1003687819 6:8322362-8322384 GCATGCAGGTGAGCAGGTGCAGG + Intergenic
1005057717 6:21745674-21745696 GCAAACAGGTGAGCAGAGGCCGG - Intergenic
1006192890 6:32220409-32220431 GCGTCCAGGTGGGCAGAGGCAGG + Exonic
1007095322 6:39209364-39209386 GCATACAGGGCAGAAGAGGCAGG - Intronic
1009948143 6:70364080-70364102 GCATGCAGGTGAGCAGGTGCAGG + Intergenic
1012523297 6:100146462-100146484 GCCTCCAGGTCTGCAGCCTCTGG - Intergenic
1015081472 6:129230726-129230748 GTATCCAGCTCAGCAGTTGCAGG + Intronic
1016339779 6:143049921-143049943 ACAACCAGGTCTGCAGCTGCAGG + Intergenic
1016569038 6:145492270-145492292 GCATGCAGGTGAGCAGGTGCAGG + Intergenic
1016858921 6:148698267-148698289 GCACCCAGGCCAGCATCTGCAGG - Intergenic
1018177368 6:161188950-161188972 GCATCAGGGTCAGCAGCAGCTGG - Intronic
1019164871 6:170091431-170091453 GCCACCAGGTCAGCAGCCCCGGG - Intergenic
1020389781 7:7646009-7646031 GCATGCAGGTGAGCAGGTGCAGG + Intronic
1021167551 7:17359758-17359780 GCACGCAGGTCAGCAGGTGCAGG + Intergenic
1023839548 7:44088637-44088659 GAAACCAGGGCAGCAGGGGCAGG - Intergenic
1029287938 7:99478967-99478989 GCATCCTGTTCAGCCGCAGCTGG + Intronic
1031025240 7:116672384-116672406 GCCTCCGGGTCACCTGCGGCCGG - Exonic
1031696224 7:124858006-124858028 GCATGCAGGTGAGCAGGTGCAGG - Intronic
1032625910 7:133591022-133591044 GCACACAGGTCAGCAGGTGCAGG - Intronic
1033071699 7:138209095-138209117 GCATGCAGGTGAGCAGGTGCAGG + Intergenic
1035279671 7:157769812-157769834 GAATCCAGGTGAGGAGCGCCTGG - Intronic
1035634120 8:1130793-1130815 GCCCCCAGCTCTGCAGCGGCTGG + Intergenic
1035695238 8:1591078-1591100 GCACCCAGTTCTGCAGCTGCCGG - Intronic
1036225065 8:6950870-6950892 GCACCAAGGTCAGCAGTGGGTGG + Intergenic
1036409351 8:8484380-8484402 GCATTCAGATCAGGAGCAGCTGG - Intergenic
1037826980 8:22165423-22165445 GCAGCCCGAGCAGCAGCGGCAGG - Exonic
1039645456 8:39277709-39277731 GCATGCAGGTGAGCAGGTGCAGG + Intronic
1039672139 8:39613149-39613171 GCATGCAGACCAGCAGTGGCTGG - Intronic
1039898041 8:41730199-41730221 GAAGCGGGGTCAGCAGCGGCTGG - Intronic
1040328402 8:46373887-46373909 GCCTCCAGGGCACCCGCGGCTGG - Intergenic
1042229180 8:66539822-66539844 GCATCCAAGTTACCAGGGGCTGG + Intergenic
1045442578 8:102228701-102228723 GCATGCAGGTGAGCAGGTGCAGG - Intronic
1046596950 8:116272503-116272525 GCATACATGTCAGCTGGGGCAGG + Intergenic
1049179824 8:141216509-141216531 GCCTCTTGGTCAGCAGCAGCCGG - Intronic
1049431374 8:142566849-142566871 GCTGCCAGGGCAGCAGCGCCAGG - Intergenic
1049547528 8:143240471-143240493 GCATCCTTCTCCGCAGCGGCTGG - Intergenic
1050475411 9:6035231-6035253 ACATCCTGGTCAGCTGCAGCAGG - Intergenic
1050829168 9:9989856-9989878 GCATGCAGGTGAGCAGGTGCAGG - Intronic
1052970238 9:34372884-34372906 GCAGCCAGGCCGGCGGCGGCGGG + Exonic
1053379377 9:37636269-37636291 GCAGCCAGGGCAGTAGAGGCCGG + Intronic
1056788825 9:89612130-89612152 GCATCCAGGTGAGAAGCAGGTGG - Intergenic
1061861146 9:133469347-133469369 GCACCAAGGCCAGCAGGGGCGGG - Exonic
1062598146 9:137308289-137308311 GGCTCCAGATCAGCTGCGGCCGG + Intronic
1185992253 X:4904285-4904307 GCATCCAGTTCTCCAGCTGCTGG - Intergenic
1186056422 X:5654428-5654450 GCATGCAGGTGAGCAGGTGCAGG + Intergenic
1188242894 X:27810631-27810653 GCATTGAGGTCAGCAGTGGAAGG + Intronic
1192917353 X:75666644-75666666 GCATCCAGGTCAGCAAAGGATGG + Intergenic
1198690673 X:139280759-139280781 GCAGCCAGGACACCAGTGGCTGG + Intergenic
1199643336 X:149883219-149883241 GCATTCAGGTCAGCAGAGCGGGG + Exonic
1199773329 X:150989243-150989265 GCATCCAGGAGACCAGCAGCAGG - Exonic
1199875176 X:151922814-151922836 GCACCCAGGTCAGTAGAGGGAGG + Intronic