ID: 1165358193

View in Genome Browser
Species Human (GRCh38)
Location 19:35317045-35317067
Sequence GTGCCGGTCCCTCCTAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165358193_1165358201 18 Left 1165358193 19:35317045-35317067 CCATCCTTAGGAGGGACCGGCAC No data
Right 1165358201 19:35317086-35317108 TAGGACCGAGCCAGGTGCGGTGG No data
1165358193_1165358200 15 Left 1165358193 19:35317045-35317067 CCATCCTTAGGAGGGACCGGCAC No data
Right 1165358200 19:35317083-35317105 GTGTAGGACCGAGCCAGGTGCGG No data
1165358193_1165358199 10 Left 1165358193 19:35317045-35317067 CCATCCTTAGGAGGGACCGGCAC No data
Right 1165358199 19:35317078-35317100 CGAACGTGTAGGACCGAGCCAGG No data
1165358193_1165358197 -1 Left 1165358193 19:35317045-35317067 CCATCCTTAGGAGGGACCGGCAC No data
Right 1165358197 19:35317067-35317089 CTCAGCCATGGCGAACGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165358193 Original CRISPR GTGCCGGTCCCTCCTAAGGA TGG (reversed) Intergenic
No off target data available for this crispr