ID: 1165358200

View in Genome Browser
Species Human (GRCh38)
Location 19:35317083-35317105
Sequence GTGTAGGACCGAGCCAGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165358194_1165358200 11 Left 1165358194 19:35317049-35317071 CCTTAGGAGGGACCGGCACTCAG No data
Right 1165358200 19:35317083-35317105 GTGTAGGACCGAGCCAGGTGCGG No data
1165358196_1165358200 -1 Left 1165358196 19:35317061-35317083 CCGGCACTCAGCCATGGCGAACG No data
Right 1165358200 19:35317083-35317105 GTGTAGGACCGAGCCAGGTGCGG No data
1165358193_1165358200 15 Left 1165358193 19:35317045-35317067 CCATCCTTAGGAGGGACCGGCAC No data
Right 1165358200 19:35317083-35317105 GTGTAGGACCGAGCCAGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165358200 Original CRISPR GTGTAGGACCGAGCCAGGTG CGG Intergenic
No off target data available for this crispr