ID: 1165362144

View in Genome Browser
Species Human (GRCh38)
Location 19:35343407-35343429
Sequence AAAATACCCCTGGAGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165362144_1165362148 3 Left 1165362144 19:35343407-35343429 CCCATCTCCTCCAGGGGTATTTT 0: 1
1: 0
2: 2
3: 23
4: 181
Right 1165362148 19:35343433-35343455 CACGCACAATTCACACACAGAGG 0: 1
1: 0
2: 0
3: 12
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165362144 Original CRISPR AAAATACCCCTGGAGGAGAT GGG (reversed) Intronic
901878685 1:12181430-12181452 CAAGAACCCCTGGAGGAGACAGG + Intronic
902238734 1:15074380-15074402 CAGAGACCCCTGGAGGAGCTTGG - Intronic
903417844 1:23196533-23196555 AAAATCTGCCTGGAGGAGAGGGG + Intergenic
903899489 1:26633248-26633270 AAAATCCCCTTGGGGGAGCTGGG + Intergenic
904615480 1:31747206-31747228 AATAGACCCCTCAAGGAGATGGG - Intronic
910505640 1:87947351-87947373 AAAATACAGGTGGAGGTGATGGG + Intergenic
910737830 1:90481560-90481582 AAAATACCCCTCAGGGAGAATGG - Intergenic
910812889 1:91255778-91255800 AAAATACCGCGGCAGGAGAATGG + Intergenic
912035147 1:105302623-105302645 TAAATAATCCTGAAGGAGATGGG - Intergenic
915359297 1:155276556-155276578 AATGTACCCCTGTAGAAGATGGG + Intronic
915922135 1:159983929-159983951 AAAAGACACCTGGAGAAGAAAGG + Intergenic
916034141 1:160906029-160906051 CCCATCCCCCTGGAGGAGATTGG + Intergenic
917587776 1:176445280-176445302 CAACAACCCCTGGAGGAGGTGGG - Intergenic
918656324 1:187030327-187030349 AAAAGTCCCATGGAGGATATAGG + Intergenic
919727334 1:200892711-200892733 AAAATACCAATGGGGGAGGTGGG - Intronic
920636648 1:207710769-207710791 AACACACCCCTGGAGCAGCTTGG - Intronic
920862907 1:209725428-209725450 AAACTCCACCTGGAGGAGGTAGG - Intronic
921644811 1:217601824-217601846 AAAATAAACCTGGTGGAGGTTGG - Intronic
922663092 1:227447329-227447351 AAAATACCTCTGGAGGATGTAGG - Intergenic
1063864010 10:10344663-10344685 CAAATGCCCTTGGAGGAGATTGG + Intergenic
1064044945 10:12005090-12005112 AAAATACTCATGGGGGAGGTGGG - Intronic
1066134144 10:32426637-32426659 AAAAGCACCCTGGAGGAAATAGG + Intergenic
1066728112 10:38412112-38412134 AAAACACCCCTGAAGGGGCTGGG - Intergenic
1068744635 10:60516396-60516418 ACAGTACCCCTGGAAGAGAGAGG + Intronic
1068834466 10:61538664-61538686 AAGATCCTCCTGGAGGAGTTAGG + Intergenic
1069532930 10:69232274-69232296 AAAACACTCCTGGAGGGGAGAGG - Intronic
1072591896 10:96833673-96833695 AATATTCCCCTGGGGGAGAAGGG - Intronic
1073458756 10:103653521-103653543 AAAATGGCCTTGGAGGAGTTTGG + Intronic
1073619805 10:105035114-105035136 AACATACCCCTGGGGGACAGTGG + Intronic
1076490586 10:130858776-130858798 GAAATGTCCCTGGAGGAGAAAGG + Intergenic
1079313459 11:19387485-19387507 AAATGTCCCCTGGAGGAAATGGG - Intronic
1080075986 11:28150144-28150166 AAAAGAGCACTGTAGGAGATTGG - Intronic
1080959086 11:37136803-37136825 AAAAGAGCCCTGGACCAGATGGG + Intergenic
1082696050 11:56365836-56365858 ACAATTTCCCTGGAAGAGATGGG + Intergenic
1082699895 11:56415741-56415763 AAAATTCACCTGGAGGAGATTGG - Intergenic
1083588807 11:63880178-63880200 CAAAAACCCCAGGAGAAGATGGG + Intronic
1084777995 11:71389756-71389778 TAAATTCTCCTGGAGGAGAGTGG - Intergenic
1085056432 11:73406876-73406898 CCAAGAGCCCTGGAGGAGATGGG + Intronic
1085076308 11:73596275-73596297 TAAATACACCAGGAGGAGAGGGG + Intronic
1086277906 11:85153299-85153321 AAAATACCTTTAGAGGAGATGGG - Intronic
1092999831 12:13983744-13983766 AAAATATCCCCAGAGGAGGTGGG - Intergenic
1094211818 12:27901167-27901189 AAAATGCACCCGGAGGAGACTGG + Intergenic
1094813709 12:34164655-34164677 AAAATGCAGCAGGAGGAGATGGG + Intergenic
1097583290 12:61484464-61484486 AAAATAGCCCAGGACCAGATGGG + Intergenic
1097756709 12:63415481-63415503 AGACTGCCCCTGGAGGAGAATGG - Intergenic
1099080797 12:78177927-78177949 AAAGTACCCCTGGTGGATAACGG - Intronic
1102007926 12:109600298-109600320 AAAACAGCCGTGGAGGAGAAAGG - Intergenic
1104691527 12:130829818-130829840 CAAATACCCATGGAGGGGGTGGG + Intronic
1105971978 13:25437451-25437473 AACATATCCCTGGAGGAGGAGGG - Intronic
1106618679 13:31353661-31353683 AAAAAATCCCTGGATTAGATTGG - Intergenic
1106953604 13:34911599-34911621 AAAATACTGATGGAGGAGAAGGG - Intergenic
1107364579 13:39656176-39656198 CAAACACCCCTGGAGGCGTTTGG + Intronic
1108247675 13:48533358-48533380 AACATAACCCTGGAGAAGGTGGG - Intergenic
1109199950 13:59419237-59419259 AAAATACCCATGAAGAACATAGG + Intergenic
1111444950 13:88335301-88335323 AATATATCCCTGGTGGAGATGGG + Intergenic
1111689298 13:91541562-91541584 AAAATACCTCTTTAAGAGATGGG - Intronic
1112835539 13:103509691-103509713 AAAATACCATGGTAGGAGATTGG + Intergenic
1112961825 13:105136362-105136384 AAAAAACTCCTGTAGGAGAAAGG - Intergenic
1113195106 13:107794290-107794312 AAAATAACCCTGGTTTAGATTGG - Intronic
1116787550 14:49304178-49304200 AATATACCATTGAAGGAGATGGG + Intergenic
1117867241 14:60162740-60162762 AAAAGACTCCTGGTGGAGGTAGG - Intronic
1118251698 14:64168074-64168096 AAAATACTCCTGGTGGTTATAGG + Intronic
1119443645 14:74646550-74646572 AAAAAAACCCTGGAGGGGATAGG + Intergenic
1119976825 14:79033947-79033969 AGAATACCACTGGAGGAGAAAGG - Intronic
1120801644 14:88696079-88696101 AAAATACCACTGGAGCAGTGAGG - Intronic
1122624525 14:103077533-103077555 TAAATAACCCTGGTGGAGGTTGG - Intergenic
1125371279 15:38980167-38980189 AAAAAAGCCCTTGAAGAGATGGG - Intergenic
1126523996 15:49629899-49629921 AATACACCCCTGGAGGACCTTGG - Intronic
1127673043 15:61213659-61213681 AAAATGCCCCGAGAGGAGTTAGG - Intronic
1129769504 15:78194148-78194170 AGAATCCCCTTGGAGGAGAAGGG + Intronic
1129775546 15:78234043-78234065 AAAGTCCCCCTTGAGGAGACAGG + Intronic
1133985080 16:10662246-10662268 CAAATGCCCCTGGGGGAAATGGG + Intronic
1138079299 16:54073534-54073556 AAAATACACATGGGGGAGGTGGG - Intronic
1138200522 16:55084884-55084906 AACAGACACCTAGAGGAGATGGG + Intergenic
1138302476 16:55944227-55944249 AAAAAGTCCCTGGAGGAGAGGGG - Intronic
1139928257 16:70504214-70504236 AAAATACCCCAGGGGGGTATGGG - Intronic
1141409808 16:83825354-83825376 GAAAGAGCCCTGGAGGAGACAGG + Intergenic
1143045006 17:4071229-4071251 AAAAGCCTCCTGGAGGATATGGG + Intronic
1143225445 17:5298641-5298663 AAAAAAATCCTGGAGGAGGTGGG - Intronic
1143721411 17:8813273-8813295 AAAAAACCTCAGGAGCAGATGGG + Intronic
1144100025 17:11934830-11934852 TAAATATCCCTGGAGGAGCATGG + Intronic
1147499851 17:40952453-40952475 AAGATAGCCCTGGAGGAGAAGGG - Intergenic
1148259304 17:46165913-46165935 AAAATTCCCCAGGAGGGGCTAGG + Intronic
1149960052 17:61098828-61098850 AAGATACCCCTGGATGGGCTGGG + Intronic
1150332869 17:64308518-64308540 AAACTTGCCCTGAAGGAGATGGG - Intergenic
1151346353 17:73504744-73504766 AATATTCCCGTGGAGGGGATAGG + Intronic
1152204907 17:78969432-78969454 AAAATAGAGGTGGAGGAGATAGG + Intergenic
1152710249 17:81867715-81867737 TAAATGCCCCTGAAGGAGCTGGG - Exonic
1154296150 18:13150673-13150695 AAAATAGACCTGGTGGAGGTGGG - Intergenic
1156515277 18:37674000-37674022 AAAAGACCCCTGGGAGAGGTAGG - Intergenic
1157793856 18:50557831-50557853 ACAGTAGCCCTGGAGGATATGGG - Intergenic
1161165937 19:2787449-2787471 AAAATTCTCCTGCAGGAGTTAGG - Intronic
1162118343 19:8445490-8445512 AACAGACCCCGGGAGGAGAGGGG - Intronic
1165308808 19:35018620-35018642 AAGATGCCCCTGGACCAGATGGG + Intronic
1165362144 19:35343407-35343429 AAAATACCCCTGGAGGAGATGGG - Intronic
1168479558 19:56707680-56707702 ACAATAGCCATGGAGGAGAGAGG + Intergenic
925828291 2:7872230-7872252 AAAAAACCACTGGAGGAGACTGG - Intergenic
926195130 2:10759100-10759122 TAAATGCCCCCGGAGGAGATAGG - Intronic
927705655 2:25294950-25294972 AAAATAACCCTGGAGGAAGTTGG + Intronic
930215599 2:48693173-48693195 AAAAGGCCACTGGAGGATATGGG + Intronic
931175365 2:59848978-59849000 AAAATTCCTCTGGAGAAGATAGG - Intergenic
932031817 2:68195501-68195523 AAAATATCCTGGGAGGAGAGGGG + Intronic
932941694 2:76174178-76174200 AAAAAAGCCCTGGACCAGATGGG - Intergenic
933818990 2:86092500-86092522 TAAAACGCCCTGGAGGAGATTGG - Intronic
934874646 2:97905918-97905940 CAAATACCTCTGGAGGATATTGG + Intronic
935221109 2:101013849-101013871 AAAATAAGCATGGTGGAGATGGG - Intronic
936694054 2:114926704-114926726 ATCACACCCCTGGAGGAGATAGG + Intronic
937524859 2:122755721-122755743 GAAATACTGCTGGAGGAGGTGGG + Intergenic
938248494 2:129796601-129796623 ACAGTACCCCTGTAGGAGACAGG + Intergenic
939313236 2:140511594-140511616 AAAAGACCCCTAGAGGGGCTGGG - Intronic
939944620 2:148394972-148394994 AACAAAGCCATGGAGGAGATAGG - Intronic
940006125 2:149010785-149010807 GAAATACCCCTGGAAGAGCCAGG + Intronic
945365548 2:208948341-208948363 AAAATCTCCCTGGAAGAAATGGG - Intergenic
945985167 2:216347757-216347779 AAAATGCCCTTGATGGAGATAGG + Intronic
948032172 2:234827908-234827930 AAAATTCACCTGGAGGCCATAGG + Intergenic
1174108370 20:48179625-48179647 AACACACCCTTGGAGGATATTGG - Intergenic
1180953080 22:19729539-19729561 AAAAGGCCCCAGCAGGAGATAGG + Intergenic
1181309155 22:21934324-21934346 ACAATGCCCCGGGAGGTGATGGG - Intronic
1183719743 22:39555782-39555804 AAAATGTCCCTGGAGGAGAATGG + Intergenic
1184871991 22:47246607-47246629 ACAGCACCCCTGGAGGAGAGAGG - Intergenic
949836445 3:8275223-8275245 AAAATCCCCATGGAGGAGCAGGG + Intergenic
950142060 3:10622238-10622260 AAAGTCCCCGTGGAGAAGATGGG - Intronic
950298668 3:11854352-11854374 AAAAAGCCCCTTGAAGAGATTGG - Intergenic
951492229 3:23284103-23284125 AAAAAATCCCTAAAGGAGATTGG - Intronic
953166259 3:40467588-40467610 AGATTACCTCTGGAAGAGATTGG - Intergenic
954874940 3:53796012-53796034 ACATTATCCCTGGAGGAGAGTGG + Intronic
955078749 3:55638234-55638256 AAAAACCCCATGGAGGAGGTTGG - Intronic
955715497 3:61825078-61825100 AAATCACCCCTAGAGGAGAAAGG - Intronic
956936535 3:74108005-74108027 ACATTACCACTGGAGGAAATTGG + Intergenic
957847872 3:85762282-85762304 GAAATAACACTGGAGAAGATAGG - Intronic
961399123 3:126622482-126622504 AAAATAGGCTTGGAGAAGATTGG - Intronic
964016974 3:151959940-151959962 CAAAAGCCCCTGGAAGAGATAGG + Intergenic
969650796 4:8466902-8466924 AAAATCCCGCTGGAAGAGCTGGG + Intronic
973829663 4:54745978-54746000 TAAATATCCCTGAAGGACATGGG - Intergenic
975112679 4:70644386-70644408 AAAATGATCTTGGAGGAGATGGG + Exonic
976137870 4:81958563-81958585 CAGCTACCCCTGGGGGAGATGGG + Intronic
976929315 4:90544973-90544995 AAAATAGTCCTGGAGCAAATTGG + Intronic
977228507 4:94423653-94423675 AAAAAAGCCCTGGACCAGATGGG + Intergenic
981235055 4:142405908-142405930 AAGCTAAGCCTGGAGGAGATGGG + Intronic
983589771 4:169395775-169395797 AAAATGCCCCTGGGGAAGAAAGG - Intronic
983612183 4:169659619-169659641 AAGAAGCCGCTGGAGGAGATTGG + Intronic
986584368 5:9299465-9299487 GAAAGTCCCCTGCAGGAGATAGG - Intronic
989748781 5:44865423-44865445 AAATTACCCTTGGAGGAGAAAGG + Intergenic
990518960 5:56558983-56559005 CAAATAGCCATGGAGGAGAATGG - Intronic
990870802 5:60430105-60430127 AAACTTGCCCTGAAGGAGATGGG - Intronic
991638016 5:68725583-68725605 TAAATACCCATGGAGAAGAGTGG - Intergenic
993503746 5:88688851-88688873 AAAATACCCTTGCAGGCGACAGG - Intergenic
993680402 5:90870793-90870815 AAAATATTAGTGGAGGAGATGGG - Intronic
995468347 5:112474345-112474367 AAAGTGCCCCTGGAGGAGATGGG - Intergenic
997726687 5:136126779-136126801 AAAATACACATGGAGCAGAGTGG - Intergenic
998270172 5:140699464-140699486 AAACTACCTCTTGAGGAGACAGG - Intronic
998365743 5:141629660-141629682 TAAGTAGCCCAGGAGGAGATGGG - Intronic
1000038650 5:157468263-157468285 AAAATTCCCCTGGAAAAGAGGGG + Intronic
1000299646 5:159944692-159944714 ACAACAACCCTGGGGGAGATGGG + Intronic
1001340705 5:170842275-170842297 AAAATACCCCTGAAAGAGAAGGG + Intergenic
1001711777 5:173784588-173784610 AAAACAGGCCTGGAAGAGATGGG - Intergenic
1002455223 5:179342403-179342425 TAAATATCCCTGGAGGAGCTGGG - Intronic
1002661508 5:180793546-180793568 TAAATAACCCTGGAGATGATGGG - Intronic
1003145579 6:3507742-3507764 AGAATAACCTTGGAGTAGATTGG - Intergenic
1004066515 6:12250772-12250794 AAGATATCCCTTTAGGAGATGGG + Intergenic
1005400191 6:25424007-25424029 AAAATAGCCATAGATGAGATAGG + Intronic
1008821645 6:55639481-55639503 AAAATTCCACTGGAGAAGACAGG + Intergenic
1009339389 6:62534374-62534396 AAAATACCTGTGAAGGAGAAAGG - Intergenic
1012313123 6:97752869-97752891 AAAAAAACCCTCGAGAAGATTGG - Intergenic
1013684071 6:112558407-112558429 AGAATATTCCTGTAGGAGATTGG - Intergenic
1014478476 6:121904977-121904999 AAAAGAGACATGGAGGAGATGGG + Intergenic
1014575021 6:123059052-123059074 AGGATACACCTGGAGGAGAGAGG - Intronic
1015592405 6:134834557-134834579 AAAATATCCCTTGATGACATCGG + Intergenic
1019864430 7:3693482-3693504 ATAATACTTCTGGAGGAAATGGG - Intronic
1021346472 7:19535251-19535273 AATATTCCCCTGGAGGTGAAGGG + Intergenic
1021415949 7:20385092-20385114 GAAATAACCCTGGAGAAGCTGGG - Intronic
1022117875 7:27278011-27278033 AAAAGACCTCTGGAGGAGGTAGG - Intergenic
1024816803 7:53280997-53281019 CAAATACCTATGGAGGAGACAGG + Intergenic
1026704790 7:72681206-72681228 AATATACACCAAGAGGAGATCGG + Intronic
1029970685 7:104785854-104785876 GAATTAACCCTGTAGGAGATAGG - Intronic
1031660552 7:124419025-124419047 CACATACACCTGGTGGAGATGGG - Intergenic
1032677058 7:134140905-134140927 AAAATAACCCTGGGGAAGCTGGG - Intronic
1032863030 7:135899455-135899477 TGAACACGCCTGGAGGAGATCGG - Intergenic
1032907962 7:136394655-136394677 AGTATACCACTGGTGGAGATAGG + Intergenic
1033471340 7:141652526-141652548 AAAATACTCTGGGAGGAGATAGG + Intronic
1034106342 7:148494019-148494041 AAAAAACCCTTGGAGGAGGCCGG - Intergenic
1036619631 8:10415984-10416006 AGAATTCCCTTGGAGGAGAGAGG - Intronic
1036747633 8:11421120-11421142 AAAAGGCCACTGGAGGAGAGTGG + Intronic
1039352885 8:36781783-36781805 AAAATTCCCCTGGAGGGGCTCGG + Intergenic
1042115245 8:65424572-65424594 AATATACCCATGGAGGAAAAAGG - Intergenic
1042200485 8:66275893-66275915 AAAATAACCCTGGAGATGACAGG - Intergenic
1042354963 8:67817204-67817226 AAAATAACCTGGGAGGGGATGGG + Intergenic
1044122643 8:88416357-88416379 GAGAAACACCTGGAGGAGATTGG - Intergenic
1044862285 8:96534783-96534805 AAAATATTCCTGGGGGAGAAGGG - Intronic
1046741985 8:117839191-117839213 AGAATACCCTTGCAGGAGTTAGG + Intronic
1047191316 8:122681481-122681503 AAAATGCAGCCGGAGGAGATGGG - Intergenic
1052814741 9:33093243-33093265 AAAATACCCTTCAAGGAGAAAGG + Intergenic
1055779814 9:79808181-79808203 AAAATACCCAGGGAGGAATTGGG - Intergenic
1058115278 9:101078013-101078035 AAAGTAGACCTGGAGGAGCTAGG + Intronic
1060359455 9:122941134-122941156 AAAATACCCCTGGGGTTGGTAGG - Intronic
1186288051 X:8066618-8066640 AAAAGACACCTGGAAGAGAGCGG - Intergenic
1187269255 X:17765046-17765068 AAAACTCCCCTGGAGGAGCAGGG + Intergenic
1188201658 X:27299608-27299630 AAAAAACTCCTGCAGGAGCTTGG - Intergenic
1189156959 X:38767732-38767754 AAAATACCTCTGCACGAGGTAGG - Intergenic
1189808688 X:44761179-44761201 AAAATTGCCCTGGAGGGGTTGGG - Intergenic
1190133528 X:47772924-47772946 GAAATACCACTGGAGAAGATGGG + Intergenic
1193180139 X:78445393-78445415 AAAATAGCCCAGGAGAAGATTGG - Intergenic
1195906721 X:109851536-109851558 ACAAGGGCCCTGGAGGAGATTGG - Intergenic
1196312655 X:114186499-114186521 TAAATGCCCCTGGAGAAAATGGG + Intergenic
1197969848 X:132103080-132103102 AAAATGCCTCTCGCGGAGATGGG - Intronic
1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG + Exonic
1200846655 Y:7837567-7837589 AAAACAGCTCTGGAGGAGGTGGG - Intergenic