ID: 1165362349

View in Genome Browser
Species Human (GRCh38)
Location 19:35344759-35344781
Sequence CCTTCCAGGCAAAGGCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 271}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165362349 Original CRISPR CCTTCCAGGCAAAGGCTGCC AGG Intronic
900992756 1:6105557-6105579 CCTCCCAGCCACAGGCTGCCGGG + Intronic
900999958 1:6143983-6144005 GCTGCTAGGCACAGGCTGCCGGG - Intronic
901118002 1:6864491-6864513 CCTTCTAGACACAGTCTGCCAGG + Intronic
901206613 1:7501172-7501194 CCTTCCAGGGAGAGCCTCCCTGG - Intronic
901219333 1:7574274-7574296 CCTTCCAAGCAGACACTGCCAGG + Intronic
901278421 1:8011243-8011265 GCCTCCATCCAAAGGCTGCCAGG + Intronic
901342185 1:8504939-8504961 CCTTCCAGAAAAATGCTTCCTGG - Intronic
901406034 1:9046376-9046398 GCTTCCAAGCCTAGGCTGCCAGG - Intronic
903447368 1:23431044-23431066 CCTTCTGGGCAGAGGCTGCCTGG + Exonic
903450759 1:23452281-23452303 GCATCCAGCCAAGGGCTGCCAGG + Intronic
903516088 1:23911950-23911972 CATTCCAGGGAAAAGCAGCCAGG + Intronic
903859743 1:26357390-26357412 GCTTCCAGGCATAGGGTGACTGG + Intergenic
904305151 1:29584087-29584109 CCTCCCAGGAACAGGCTTCCAGG - Intergenic
909120749 1:71600517-71600539 GCTGCCAGCCAAAGGCAGCCAGG + Intronic
909523072 1:76591732-76591754 CCTCCCAGGTAGAGGCAGCCAGG - Intronic
909658135 1:78053501-78053523 CCTTCCAGGCAAAGACCACCAGG - Intronic
911064053 1:93771981-93772003 CCTTCTTGCCAAGGGCTGCCAGG - Intronic
912386277 1:109272689-109272711 CCTTCCAGGAACAGGCTGCCTGG - Exonic
914901168 1:151711880-151711902 CCCTCCTGGCATAGGCTCCCAGG + Intronic
915928437 1:160042020-160042042 CCTTCCTGGCGAAGATTGCCCGG - Exonic
918082359 1:181217459-181217481 CTTTTCAGGCAAAGGAGGCCAGG - Intergenic
918299074 1:183185995-183186017 CATTCCAGGCAAAGGCTCCCGGG + Intergenic
918525178 1:185456873-185456895 CCTTCCAGGCAGAGGGAGCAGGG - Intergenic
918997744 1:191784061-191784083 ACTGCCAGGCCAAGGCTGCAAGG + Intergenic
919479121 1:198064647-198064669 CTTTCCAGCCAAAGGCTGGAGGG - Intergenic
921527414 1:216234926-216234948 GCTTCCAGGAAAAGACTGCATGG + Intronic
921620971 1:217325865-217325887 CCTTCTGGGCTAAGGCTGACTGG - Intergenic
922196715 1:223365014-223365036 CCTCCCAGGCCAAGGCTCCGAGG - Intergenic
922752468 1:228077018-228077040 GCTTCCAGGCAGAGGCTAGCAGG - Intergenic
922803625 1:228374968-228374990 CCTGCCAGCCCAAGGCAGCCTGG - Intronic
923335774 1:232968911-232968933 CCTTCCTGGGGAAGGCTGACAGG - Intronic
923573519 1:235137800-235137822 CCTTCCAGGAAAAGCCTGGAAGG + Intronic
924434726 1:244028903-244028925 TTATCCAGGCAAAGGCTGCAGGG - Intergenic
1063186735 10:3658737-3658759 CCTTCCAGTGAAGAGCTGCCTGG + Intergenic
1063879015 10:10511586-10511608 CCTTCAAGACAAAAGCTCCCAGG - Intergenic
1064329428 10:14379773-14379795 CCTTCCCTGCCAAGGTTGCCAGG - Intronic
1067693687 10:48520465-48520487 CCTTCAAGGCAGAGCCTGACAGG + Intronic
1068892630 10:62163606-62163628 CCTTCTAGGCAGATGATGCCTGG + Intergenic
1069029959 10:63585192-63585214 CTTTCCAGGCACAGGGTGCTAGG + Intronic
1073067983 10:100775152-100775174 CCTTCCAGGTCAAACCTGCCTGG + Intronic
1073116713 10:101095553-101095575 ACTTCCAGGTAAAGGCTGGAAGG - Intronic
1073454864 10:103630283-103630305 GCTTCCTGGCAGAGGCTGCTGGG - Intronic
1073586214 10:104712596-104712618 CCTTCAAGGAACACGCTGCCAGG - Intronic
1075629201 10:123991028-123991050 CCATCCAGGCCAAGGCAGACTGG + Intergenic
1075689255 10:124384755-124384777 GCTGGCAGGCTAAGGCTGCCGGG - Intergenic
1076250786 10:128982464-128982486 GCTTCCAGACAGAGGCTGCCAGG + Intergenic
1076359324 10:129875809-129875831 TCCTCCAGGCAGAGGCTGCCAGG - Intronic
1076400571 10:130181932-130181954 CCCTCCATACAAAGCCTGCCTGG - Exonic
1076471752 10:130723941-130723963 CCTCCCTGGAAAAGCCTGCCTGG - Intergenic
1076499949 10:130929492-130929514 GCTTCCAGTCCATGGCTGCCTGG - Intergenic
1077332915 11:1991186-1991208 GCTTCCAGGAAACGGCTGCAGGG + Intergenic
1078157913 11:8814522-8814544 CTATCCAGGCAAAGACTGCTTGG - Intronic
1078480753 11:11673202-11673224 CCTGCAAGGCTAAGGATGCCAGG - Intergenic
1079103135 11:17553650-17553672 CCTTCCAGGTGCAGACTGCCTGG - Intronic
1079225792 11:18603678-18603700 CCTCCCAGGCAAGGACTGGCAGG - Intergenic
1079536330 11:21519750-21519772 ACTTCCAGGGGAAGGCTTCCAGG - Intronic
1081513575 11:43801819-43801841 CCTTCTTGTCAAAGGCTGCCTGG + Intronic
1081661207 11:44889493-44889515 CATTCCAGACACAGGCTGGCTGG + Intronic
1081699537 11:45144428-45144450 GCTTCCTGGCAAAGGAAGCCAGG + Intronic
1082000938 11:47393452-47393474 CGACCCAGGCAAAGGCTGGCTGG - Intergenic
1082803697 11:57432855-57432877 GCTTCCAAGCAGAGGCTCCCAGG - Intergenic
1084669170 11:70595209-70595231 CCCTCCTGGCCAAAGCTGCCTGG - Intronic
1085050567 11:73377952-73377974 CCTCCCACCCAAAGGCTTCCTGG + Intronic
1085647968 11:78240241-78240263 CATTCCAGGGAAAGGATGCCTGG + Intronic
1086278166 11:85156772-85156794 CTTCCCAGGCAAAGGCTACCTGG + Intronic
1087505774 11:99019797-99019819 GCTTCCAGCTACAGGCTGCCTGG + Intergenic
1089774847 11:120828950-120828972 GCTGCCTGGCAGAGGCTGCCGGG - Intronic
1090603315 11:128394899-128394921 CTGGCAAGGCAAAGGCTGCCTGG - Intergenic
1202815898 11_KI270721v1_random:46362-46384 GCTTCCAGGAAACGGCTGCAGGG + Intergenic
1091450266 12:568537-568559 CCTGCGGGGCACAGGCTGCCAGG - Intronic
1091661274 12:2385554-2385576 ATTTCCAGGCAAAAGCTGCCAGG - Intronic
1091670379 12:2448018-2448040 CCCACCAGGCAAAGGCTGCCTGG - Intronic
1091997019 12:5001689-5001711 TCTACGAGGCAAAGGCTCCCAGG - Intergenic
1094536116 12:31324306-31324328 CCTCCCAGACACAGGCTCCCGGG + Intronic
1094850040 12:34378267-34378289 CCTTCCACTCAAAGGGTGCCTGG + Intergenic
1096578017 12:52566727-52566749 CCTGCCAGCCAAAGGCAGCGAGG + Exonic
1098140367 12:67444617-67444639 CCTTCCAGGGAAAAGGTGCCAGG - Intergenic
1099594950 12:84649485-84649507 CCTTTCAGCCAAAAACTGCCAGG - Intergenic
1100568179 12:95818865-95818887 CCATCCAGGCCAAGTTTGCCAGG - Intronic
1101613128 12:106310147-106310169 CCTTCCAGGGAAGGGCCGTCAGG - Intronic
1103081446 12:118027096-118027118 CCTTGCTGGCAAAGGATGACTGG + Intronic
1103598200 12:122037112-122037134 CCCTCGAGGCAAGGGCTGCCTGG + Intronic
1103924419 12:124415669-124415691 CGTTCCAGGCAGGGGCTCCCAGG - Intronic
1105505567 13:21006643-21006665 ACTTCCAGACAAAGGCTGCCTGG + Intronic
1107882388 13:44843913-44843935 CCCTCCAGGCAAAGACCACCAGG - Intergenic
1109667400 13:65557474-65557496 CCTCTCAGGCAAAGGCTTCTAGG - Intergenic
1109888383 13:68574236-68574258 CAGTCCAGGCAAAAGCTGACTGG + Intergenic
1112011512 13:95297568-95297590 CCATCCAGGAAGTGGCTGCCTGG - Intronic
1112412135 13:99173605-99173627 CTTCCCAGCCACAGGCTGCCAGG + Intergenic
1114766299 14:25374419-25374441 CTTTCCAAGCAGAGGCTACCAGG - Intergenic
1115443479 14:33462682-33462704 CCTTCCAGCCTAAGGCACCCGGG + Intronic
1115694275 14:35879463-35879485 CCTTCCAGCCAAAGGCCACCAGG - Intronic
1116861878 14:50001789-50001811 CCTTCCACGGAGAGGCTGCCGGG + Intronic
1118039027 14:61897882-61897904 ACTTTCAAGCAAAGCCTGCCGGG - Intergenic
1120863580 14:89276539-89276561 CCTTCTTGGAAAAGGCTGCTTGG - Intronic
1120887018 14:89459772-89459794 CCTTCCTAGCAAAGGGTTCCGGG - Intronic
1122280581 14:100619975-100619997 CCTCCCAGGCAAGGCCTCCCTGG - Intergenic
1122750398 14:103928601-103928623 CCTTCCCGGCAGGGGCGGCCAGG + Exonic
1122918130 14:104868183-104868205 CATCCCTGGCAAAGGCTGCCTGG - Intronic
1122924742 14:104894418-104894440 CCAGCCAGGCAAAGGCAGGCTGG - Intronic
1123681301 15:22766037-22766059 ACTTTCAGGCTCAGGCTGCCTGG + Intergenic
1123923356 15:25086327-25086349 CCTTCCATGCCAATGCTACCTGG - Intergenic
1124030263 15:26004216-26004238 CCTTCTAGGCAATCACTGCCAGG - Intergenic
1124088829 15:26578703-26578725 CTTTCTAGGCAAAGGCTGCATGG + Intronic
1124333515 15:28840499-28840521 ACTTTCAGGCTCAGGCTGCCTGG + Intergenic
1126110128 15:45170067-45170089 CCTCCCAGGCTAAGGCAGGCTGG + Intronic
1126142538 15:45449963-45449985 CATTCCAGCCACAGTCTGCCTGG - Intergenic
1131968822 15:97872190-97872212 CTTTCCTGGTCAAGGCTGCCAGG - Intergenic
1132318862 15:100910372-100910394 CCCTCCAGGGACAGGCAGCCAGG + Intronic
1132765190 16:1530939-1530961 CCTGCCAGGCCGAGGCTGCTGGG + Intronic
1132861896 16:2075959-2075981 CCTTGGGGACAAAGGCTGCCGGG - Intronic
1133277358 16:4646953-4646975 CCCTCCAGACCAAGGCTGCCCGG + Intronic
1137023689 16:35453806-35453828 GCTCCCAGGGAAATGCTGCCAGG + Intergenic
1137555228 16:49466143-49466165 CCCTCCGGCCAAAGGCTACCAGG + Intergenic
1138155841 16:54702189-54702211 CCTCCCAGGCAGAGGCCGTCAGG - Intergenic
1138553529 16:57759654-57759676 CCATCCAGGTAAGGGCAGCCTGG + Intronic
1138589827 16:57993688-57993710 CCTCCCAGGAAGAGGATGCCCGG - Intergenic
1139473334 16:67189839-67189861 CCTAGCAGGCAAAGCCTCCCAGG - Intronic
1139853367 16:69963435-69963457 CCTTCCTAGCAGAGGCTGCTGGG - Intronic
1139882336 16:70186344-70186366 CCTTCCTAGCAGAGGCTGCTGGG - Intronic
1139891511 16:70255874-70255896 CCCCCCAGCCAAGGGCTGCCAGG - Intronic
1140370173 16:74409160-74409182 CCTTCCTAGCAGAGGCTGCTGGG + Intronic
1141342206 16:83213502-83213524 CCTGCCAGGAAAAGCCTTCCGGG - Intronic
1143088686 17:4435568-4435590 ACTTCCAGGCAGAGGCCCCCAGG + Intronic
1143275703 17:5708205-5708227 CCTCCCAGGAAAATGCTCCCTGG + Intergenic
1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG + Intronic
1146621996 17:34405935-34405957 CTCTCCAGGCACAGGCTCCCAGG - Intergenic
1147184619 17:38706356-38706378 CCTGCCTGGCACAGGCAGCCGGG + Intronic
1147841351 17:43374057-43374079 CCATCCAGCCAAAGGCCACCAGG + Intergenic
1148904699 17:50904858-50904880 CCTGCCAGCCACAGGCTGCTGGG - Intergenic
1151387623 17:73764721-73764743 CATTGCAGGCCAGGGCTGCCAGG + Intergenic
1151431472 17:74066383-74066405 CCTTCCAGCCAAAGGCAGAAAGG + Intergenic
1152230828 17:79113214-79113236 CCTTCCTCCCAGAGGCTGCCCGG - Intronic
1152272497 17:79333152-79333174 CCTCCCTGGTAAAGGCTGGCAGG - Intronic
1153682576 18:7514475-7514497 CCCTCCAGCCAAAGGCTACCAGG + Intergenic
1153881713 18:9426950-9426972 CCCTCCGGGCCAGGGCTGCCTGG + Intergenic
1156328145 18:36093219-36093241 CCTTCCAGCCAAAGACCACCAGG - Intergenic
1156674129 18:39507288-39507310 TCTTGCAGCCAAAGGCTGCACGG - Intergenic
1157561242 18:48647988-48648010 CCTGCCAGGGAAAGGCTTCCAGG - Intronic
1158558949 18:58497975-58497997 CCTTCCAGGCAGACACTGTCAGG - Intronic
1160018388 18:75161801-75161823 CCATCCGGGCACAGGCTTCCTGG + Intergenic
1160239206 18:77111106-77111128 CCTCCCAGGCAAACATTGCCAGG - Intronic
1160691825 19:463857-463879 CCTGCGGGGCACAGGCTGCCCGG - Exonic
1165059467 19:33198035-33198057 ATTTCCAGGAAAAGGCTGACTGG + Intronic
1165362349 19:35344759-35344781 CCTTCCAGGCAAAGGCTGCCAGG + Intronic
1165758362 19:38307115-38307137 CCTTCCAGGGAAATTCTGGCAGG + Intronic
1166770353 19:45278192-45278214 CCGTCCAGGGAAAAGCTCCCAGG + Intronic
1167135588 19:47613394-47613416 CCTTCCAAGCCCAGGCGGCCTGG - Intronic
1167591616 19:50407227-50407249 CCCTCCAGGCAATGGCATCCTGG + Intronic
1168146140 19:54420892-54420914 CCTGCCTGGCAAAGGATGCGGGG + Intronic
1168510588 19:56970586-56970608 CCTGCCAGGCACAGGGTTCCAGG - Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925942304 2:8832263-8832285 CCCTCTAGTCAAAGACTGCCAGG - Intronic
926322314 2:11757607-11757629 CCCTCCAGGCAACAGGTGCCTGG + Intronic
927094663 2:19738557-19738579 GCTTCCAGGCTCAGGTTGCCTGG + Intergenic
927878432 2:26674160-26674182 TGTGCCAGGCAAAGGCAGCCTGG - Intergenic
928379098 2:30802774-30802796 CTTTTCAGGCAGAGGCTCCCAGG - Intronic
929419932 2:41780172-41780194 CCATCCAGGTGAAAGCTGCCTGG - Intergenic
929581741 2:43085704-43085726 CCTTCCAGGCCATCTCTGCCAGG + Intergenic
932365957 2:71153769-71153791 ACTTCCAGGCTCAGGCTGCCTGG - Intergenic
933376191 2:81482288-81482310 CCTTCAAGCCAAAGACAGCCTGG - Intergenic
933773313 2:85757155-85757177 CCTTCCCCAGAAAGGCTGCCAGG + Intronic
936548265 2:113411793-113411815 CATTCCATGCAAAGTCTGTCTGG + Intergenic
938935948 2:136127675-136127697 CATGCCAGGCTTAGGCTGCCTGG + Intergenic
943794911 2:191980289-191980311 CCTTCCAGGGTAGGGCTGCTGGG - Intronic
944023333 2:195133147-195133169 CCTGCCAGGCAAAGAATACCAGG - Intergenic
947460467 2:230299721-230299743 AGCTCCAGGCAAAGGATGCCTGG + Intronic
948487687 2:238291221-238291243 CCTCCCAGCTAAAGGCTGCTTGG + Intergenic
948739042 2:240030938-240030960 GCTCCCAGGAAAGGGCTGCCTGG + Intergenic
948778125 2:240300544-240300566 CCTGTCAGTCAAAGGCTCCCTGG - Intergenic
948782203 2:240328805-240328827 CCTTCCATTCAGGGGCTGCCGGG - Intergenic
1169171555 20:3469838-3469860 CGTGCCCGGCCAAGGCTGCCAGG + Intergenic
1174056556 20:47802324-47802346 CATTGCAGGCAAAGCCGGCCAGG - Intergenic
1175766854 20:61598225-61598247 CCTTCCAGGAATTGGCTGCTGGG + Intronic
1175988184 20:62774676-62774698 CCTTCCAGGCAGGGGCTGAGGGG + Intergenic
1176273931 20:64252947-64252969 TCGTCAAGCCAAAGGCTGCCAGG + Intergenic
1176896371 21:14383335-14383357 CCTTCCACGCAACGGCCGGCAGG + Intronic
1178602031 21:34002833-34002855 CCTTCCAGGCAGTGGCTTTCAGG - Intergenic
1180889269 22:19273931-19273953 CCTTCCAGCCAAAGACCACCAGG - Intronic
1181015105 22:20064124-20064146 CCTTCCAGACAGAGGAGGCCTGG + Intronic
1181443566 22:22951399-22951421 CCATCCAGCCTAAGGCTTCCTGG + Intergenic
1182896159 22:33861076-33861098 TGTTCGAGGCAGAGGCTGCCTGG - Intronic
1183469961 22:37999965-37999987 CCTAGCGGGCACAGGCTGCCAGG - Intronic
1184161874 22:42701813-42701835 CCGTCAAGGTAGAGGCTGCCTGG + Intronic
1184946671 22:47808736-47808758 CCTTGCGGGCAGAGGCTGCACGG + Intergenic
1184985954 22:48134311-48134333 CCATCCAAGCAGGGGCTGCCAGG + Intergenic
950309869 3:11947977-11947999 CCTCTGAGGCAAAGGCAGCCAGG - Intergenic
950473336 3:13199779-13199801 TGCTCCAGGCAAATGCTGCCAGG + Intergenic
950793905 3:15495178-15495200 CCCTCCAAGCAAAGGCTTCAGGG + Intronic
951233064 3:20201805-20201827 ACCTCCAGCCAAAGACTGCCAGG - Intergenic
953607128 3:44419459-44419481 CCTTGGAGGGAAAGGTTGCCAGG - Intergenic
954284719 3:49610750-49610772 ACTTCCAGGGAAACCCTGCCTGG - Intronic
954304795 3:49719839-49719861 GCTGCCAGCCAAAGGCTGACGGG - Intronic
954902439 3:54031405-54031427 CAGTTCAGGAAAAGGCTGCCAGG + Intergenic
955378750 3:58419753-58419775 CTTTCCAGGAAAAGGCTGTGGGG + Intronic
958160488 3:89812037-89812059 TCTAGCAGGCATAGGCTGCCTGG - Intergenic
959528793 3:107408543-107408565 CCTTGGTGGCAAAAGCTGCCAGG - Intergenic
961739824 3:129026259-129026281 GTTTCCTGGCACAGGCTGCCTGG - Intronic
963863583 3:150335886-150335908 TCTTCAAAGCAGAGGCTGCCTGG + Intergenic
964469779 3:157040553-157040575 GCTTCCATTCAAAGGCTTCCAGG - Intronic
964658380 3:159093274-159093296 ATTTTCAGGCAAAGGCTGGCTGG - Intronic
965970231 3:174545391-174545413 CCTTCCTAGGAAAGGGTGCCTGG + Intronic
967121598 3:186387177-186387199 CCATCCAGGCAGGGACTGCCTGG - Intergenic
967962494 3:194937309-194937331 CCTTCCAGGCAAAGGTAACATGG + Intergenic
968130711 3:196191352-196191374 CCTGCCAGGAAAAGGCAGGCAGG + Intergenic
969605888 4:8202111-8202133 CCTTGCAGGCAGGGGCTTCCTGG + Intronic
972565378 4:40264764-40264786 TCTTGCAGCCAAAGGCTGCATGG + Intergenic
973700102 4:53528771-53528793 CCTTCCAGGGAGATGGTGCCAGG - Intronic
976444471 4:85114761-85114783 GCTTCCTGCCAGAGGCTGCCGGG - Intergenic
976562126 4:86513863-86513885 GCTTTCAGGCTAAGGCTACCTGG - Intronic
979107437 4:116705674-116705696 CCTTCCTTGCAGAGGCTGCAGGG - Intergenic
980807456 4:137831821-137831843 CCTTCCTGGCAGAGTCTGCCAGG + Intergenic
983998263 4:174212016-174212038 CCGCGCAGGAAAAGGCTGCCTGG - Intergenic
985544976 5:504897-504919 TCTTCCAGGCACAGGCGTCCGGG - Intronic
985958793 5:3284039-3284061 CTCTCCAGGAAATGGCTGCCCGG - Intergenic
986392292 5:7298031-7298053 ACTTTCAGGCTCAGGCTGCCTGG + Intergenic
989985277 5:50689883-50689905 CATTCCAGCCCAAGGCTGCTGGG + Intronic
990249514 5:53898733-53898755 CCTTCCAGGCTCAGGTAGCCTGG + Intronic
990983504 5:61621685-61621707 CCTTCCAGGCCTCAGCTGCCAGG - Intergenic
992570460 5:78050109-78050131 CCTTCCAGGTAGAGGGTCCCAGG - Intronic
993945406 5:94111828-94111850 CCTTCCTTGTGAAGGCTGCCTGG + Intergenic
996354612 5:122581831-122581853 CCTTCCAGACAGAAGCTGCTGGG - Intergenic
997695356 5:135857007-135857029 CCTTCCAGGGACAAGGTGCCAGG - Intronic
997848259 5:137307785-137307807 CCTTCCAGGCAAAGTCCTCAAGG - Intronic
998169247 5:139862601-139862623 CCATACAGTCATAGGCTGCCTGG + Intronic
998504365 5:142660276-142660298 CCTTCCAGTCAGAGGCTGAGTGG - Intronic
1000042874 5:157498171-157498193 CCTTCCAGGAGAAGGCAGACAGG + Intronic
1000162164 5:158608694-158608716 CCTTCCAGTCAAAGACCACCAGG - Intergenic
1000930485 5:167245266-167245288 CCTCCCAGACAAAGGGTGCACGG + Intergenic
1001279963 5:170379600-170379622 CCCTCCAGGCAATGGATGTCAGG + Intronic
1001919798 5:175590912-175590934 CCTTTCATGCAGAGGCTGCTAGG - Intergenic
1002318488 5:178361035-178361057 ACATCCAAGCAAAGGCTGCCTGG + Intronic
1002764384 6:226713-226735 CCTTCCATGAAAAGTCTGCATGG - Intergenic
1004039423 6:11961077-11961099 CATTCCAGGCAGAGGGTGCAGGG - Intergenic
1006298175 6:33179256-33179278 CCTTTCAGGCCAGGGCTCCCAGG + Exonic
1009868992 6:69432696-69432718 CCTCCCAGACAAAGGGTGGCCGG + Intergenic
1009869047 6:69432882-69432904 CCTCCCAGACAAAGGGTGGCCGG + Intergenic
1011758641 6:90533285-90533307 CCCTCTAGCCAAAGACTGCCAGG + Intronic
1012797442 6:103780535-103780557 CCTTCCATGTAAAGCCTTCCAGG + Intergenic
1015517090 6:134093450-134093472 CCCTCTAGCCAAAGGCTACCGGG - Intergenic
1016367675 6:143337067-143337089 CCTTCCAGGCACAGGGTCACAGG + Intronic
1019749678 7:2721166-2721188 CCTCCCAGGCACAGGCGTCCTGG - Intronic
1020255496 7:6500893-6500915 CCTACCAGCCAAAGGCAGTCAGG - Intronic
1021123588 7:16825349-16825371 CCCTTCAAGAAAAGGCTGCCTGG + Intronic
1022206155 7:28165618-28165640 TGTTCCAGGCAGAGGCTGCAAGG - Intronic
1022563018 7:31369475-31369497 CTTTACAGGCACAGGATGCCGGG + Intergenic
1023048104 7:36228997-36229019 CCTTAGAGAGAAAGGCTGCCTGG + Intronic
1023859427 7:44208572-44208594 CCTTCAATGCAAACGCTGCAAGG - Intronic
1023868061 7:44248249-44248271 CCTTCCAGGCCATGACTGGCTGG + Intronic
1023992446 7:45136587-45136609 ACTTCCAGGCGAAGGCCACCAGG - Intergenic
1024954016 7:54896793-54896815 ACTTCCTGGGAAAGGATGCCTGG + Intergenic
1025951954 7:66152398-66152420 ACGTCCAGGAAATGGCTGCCAGG - Exonic
1025970522 7:66320172-66320194 CCTCCCAGCCAAAGGTTACCAGG - Intronic
1026867177 7:73831003-73831025 CCTTCCAGCCGACAGCTGCCAGG - Exonic
1027697962 7:81434811-81434833 CCTTTCAGGCCCAGCCTGCCTGG - Intergenic
1028070614 7:86445626-86445648 ACTTCCAGGCAAAAGCTGTAAGG + Intergenic
1034896082 7:154877354-154877376 ACTTCCAGGCAAAGGCATCCTGG - Intronic
1036613020 8:10366224-10366246 TGTTCCAGGCAAAGGCAGCTTGG + Intronic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1037769663 8:21790905-21790927 GCCTCCAGGCCAAGCCTGCCTGG - Intronic
1039984576 8:42436724-42436746 GCTTCCAGGGAAGGGCTGGCCGG - Intronic
1042218683 8:66452305-66452327 CCTAAAAGGCAAAGGCAGCCAGG + Intronic
1042557047 8:70042541-70042563 CCCTCCAGGCTCTGGCTGCCTGG - Intergenic
1042739602 8:72028360-72028382 CCTTCCAGGCAAAGGGGCCTTGG + Intronic
1046389208 8:113546228-113546250 CCTTCCAGCCAAAGACCACCAGG - Intergenic
1048407846 8:134141251-134141273 CCCTCCAGCCAAAGACTACCAGG + Intergenic
1048411088 8:134173711-134173733 TCTTCCAGCCAGAGTCTGCCTGG + Intergenic
1048818380 8:138355601-138355623 CCTTCCAGCCAATGACTGACAGG - Intronic
1049584279 8:143425753-143425775 CCTTCCTGGAGGAGGCTGCCTGG - Intronic
1049781202 8:144429769-144429791 CCTTCCTGGAAAAGGCGGCCTGG + Intronic
1052757114 9:32552355-32552377 CCTCCCAGGCGGTGGCTGCCAGG - Intronic
1053149230 9:35732299-35732321 CCTGCCAGGGAGGGGCTGCCGGG - Exonic
1053727297 9:41016994-41017016 CATTCCATGCAAAGTCTGTCTGG - Intergenic
1053887071 9:42651722-42651744 CATTCCGGGGGAAGGCTGCCTGG - Intergenic
1054226091 9:62459172-62459194 CATTCCGGGGGAAGGCTGCCTGG - Intergenic
1054701220 9:68415118-68415140 CATTCCATGCAAAGTCTGTCTGG + Intronic
1055482843 9:76726875-76726897 CCTTCCAGGCAGAGAATACCTGG + Intronic
1056683865 9:88743695-88743717 CCTTCCAGTCAAAGCCTTCCCGG + Intergenic
1056781862 9:89556406-89556428 CCTTCCAGGTGAGGGATGCCAGG - Intergenic
1057437808 9:95058527-95058549 CCCTCCAGACAAAGGCAGGCAGG - Intronic
1057616492 9:96595321-96595343 GCATCCAGTCAAAGACTGCCAGG + Intronic
1058221980 9:102314059-102314081 CCTTCCAGCAAAATTCTGCCTGG - Intergenic
1058461101 9:105183653-105183675 CCTGCGAGGCAAAGGTTGCAGGG + Intergenic
1061234421 9:129334332-129334354 CCTTCCAGGCAGAGCCTTCAGGG - Intergenic
1061939319 9:133875569-133875591 CCTTGGAGGCACAGACTGCCCGG + Intronic
1062041229 9:134405177-134405199 CCTTCCAGCCCCAGGCTGCTGGG - Intronic
1062101262 9:134729864-134729886 CCTTCCAGGGAAAGGTGACCTGG + Intronic
1062355877 9:136162091-136162113 GCCTCCAGGCAGAGGCTGCTGGG - Intergenic
1185921119 X:4093958-4093980 CCTGACAGGCAAAGGTTGCAGGG + Intergenic
1186230621 X:7449836-7449858 CCTTCCAGGCATACCCAGCCTGG + Intergenic
1186487876 X:9947366-9947388 TCATCCAGGCATGGGCTGCCAGG + Exonic
1188308418 X:28586917-28586939 TCTTCCAGGCAAAAGCAGACTGG - Intergenic
1188515786 X:30984240-30984262 GCTTCCAGAAAAAGGCTGTCAGG - Intergenic
1188594230 X:31877507-31877529 CCACACAGGGAAAGGCTGCCAGG - Intronic
1189341170 X:40205722-40205744 CATCCGAGACAAAGGCTGCCCGG - Intergenic
1197763249 X:130042487-130042509 TTTTCCATGCAAAGGCAGCCTGG + Intronic
1198224049 X:134629227-134629249 TCTTACAGGCAAATGCTGACTGG + Intronic
1198403646 X:136291221-136291243 CCTTCCAGCCAAAGACTACCAGG - Intergenic
1200875758 Y:8153061-8153083 CCTTCCAGACAGAGACTGCAGGG - Intergenic
1202239729 Y:22754114-22754136 CCTTCCAGACAGAGACTGCAGGG + Intergenic
1202478068 Y:25282241-25282263 CCTTCCAGACAGAGACTGCAGGG - Intergenic