ID: 1165365162

View in Genome Browser
Species Human (GRCh38)
Location 19:35360745-35360767
Sequence GATGAAGGAGTGGCCCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165365152_1165365162 30 Left 1165365152 19:35360692-35360714 CCTTCTATCTCTCAATAGCCCTG No data
Right 1165365162 19:35360745-35360767 GATGAAGGAGTGGCCCAGAGAGG No data
1165365154_1165365162 12 Left 1165365154 19:35360710-35360732 CCCTGTGAGAGGTACCAGCATTA No data
Right 1165365162 19:35360745-35360767 GATGAAGGAGTGGCCCAGAGAGG No data
1165365155_1165365162 11 Left 1165365155 19:35360711-35360733 CCTGTGAGAGGTACCAGCATTAT No data
Right 1165365162 19:35360745-35360767 GATGAAGGAGTGGCCCAGAGAGG No data
1165365156_1165365162 -2 Left 1165365156 19:35360724-35360746 CCAGCATTATCCCCAGTTTCAGA No data
Right 1165365162 19:35360745-35360767 GATGAAGGAGTGGCCCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165365162 Original CRISPR GATGAAGGAGTGGCCCAGAG AGG Intergenic
No off target data available for this crispr