ID: 1165365319

View in Genome Browser
Species Human (GRCh38)
Location 19:35361760-35361782
Sequence CTGTATAAGCAAAAGCCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165365312_1165365319 -8 Left 1165365312 19:35361745-35361767 CCAGCCCAGCCCAGTCTGTATAA No data
Right 1165365319 19:35361760-35361782 CTGTATAAGCAAAAGCCCAGGGG No data
1165365311_1165365319 -7 Left 1165365311 19:35361744-35361766 CCCAGCCCAGCCCAGTCTGTATA No data
Right 1165365319 19:35361760-35361782 CTGTATAAGCAAAAGCCCAGGGG No data
1165365310_1165365319 3 Left 1165365310 19:35361734-35361756 CCAGCTATCTCCCAGCCCAGCCC No data
Right 1165365319 19:35361760-35361782 CTGTATAAGCAAAAGCCCAGGGG No data
1165365308_1165365319 5 Left 1165365308 19:35361732-35361754 CCCCAGCTATCTCCCAGCCCAGC No data
Right 1165365319 19:35361760-35361782 CTGTATAAGCAAAAGCCCAGGGG No data
1165365309_1165365319 4 Left 1165365309 19:35361733-35361755 CCCAGCTATCTCCCAGCCCAGCC No data
Right 1165365319 19:35361760-35361782 CTGTATAAGCAAAAGCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165365319 Original CRISPR CTGTATAAGCAAAAGCCCAG GGG Intergenic
No off target data available for this crispr