ID: 1165366980

View in Genome Browser
Species Human (GRCh38)
Location 19:35373213-35373235
Sequence GATGAAGGAGTGGCCCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165366973_1165366980 11 Left 1165366973 19:35373179-35373201 CCTGTGAGAGGTACCAGCATTAT No data
Right 1165366980 19:35373213-35373235 GATGAAGGAGTGGCCCAGAGAGG No data
1165366972_1165366980 12 Left 1165366972 19:35373178-35373200 CCCTGTGAGAGGTACCAGCATTA No data
Right 1165366980 19:35373213-35373235 GATGAAGGAGTGGCCCAGAGAGG No data
1165366974_1165366980 -2 Left 1165366974 19:35373192-35373214 CCAGCATTATCCCCAGTTTCAGA No data
Right 1165366980 19:35373213-35373235 GATGAAGGAGTGGCCCAGAGAGG No data
1165366970_1165366980 30 Left 1165366970 19:35373160-35373182 CCTTCTATCTCTCAATAGCCCTG No data
Right 1165366980 19:35373213-35373235 GATGAAGGAGTGGCCCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165366980 Original CRISPR GATGAAGGAGTGGCCCAGAG AGG Intergenic
No off target data available for this crispr