ID: 1165369502

View in Genome Browser
Species Human (GRCh38)
Location 19:35395729-35395751
Sequence CTCTCACTTGGTCAGAATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165369502_1165369505 -5 Left 1165369502 19:35395729-35395751 CCTTGATTCTGACCAAGTGAGAG No data
Right 1165369505 19:35395747-35395769 GAGAGCAGATAAGGCAGCACAGG No data
1165369502_1165369506 -4 Left 1165369502 19:35395729-35395751 CCTTGATTCTGACCAAGTGAGAG No data
Right 1165369506 19:35395748-35395770 AGAGCAGATAAGGCAGCACAGGG No data
1165369502_1165369507 11 Left 1165369502 19:35395729-35395751 CCTTGATTCTGACCAAGTGAGAG No data
Right 1165369507 19:35395763-35395785 GCACAGGGATTCAAGCTGCCTGG No data
1165369502_1165369509 23 Left 1165369502 19:35395729-35395751 CCTTGATTCTGACCAAGTGAGAG No data
Right 1165369509 19:35395775-35395797 AAGCTGCCTGGAGACCTCCAGGG No data
1165369502_1165369508 22 Left 1165369502 19:35395729-35395751 CCTTGATTCTGACCAAGTGAGAG No data
Right 1165369508 19:35395774-35395796 CAAGCTGCCTGGAGACCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165369502 Original CRISPR CTCTCACTTGGTCAGAATCA AGG (reversed) Intergenic
No off target data available for this crispr