ID: 1165369504

View in Genome Browser
Species Human (GRCh38)
Location 19:35395741-35395763
Sequence CTGCCTTATCTGCTCTCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165369504_1165369511 22 Left 1165369504 19:35395741-35395763 CCAAGTGAGAGCAGATAAGGCAG No data
Right 1165369511 19:35395786-35395808 AGACCTCCAGGGTCACTGTGAGG No data
1165369504_1165369509 11 Left 1165369504 19:35395741-35395763 CCAAGTGAGAGCAGATAAGGCAG No data
Right 1165369509 19:35395775-35395797 AAGCTGCCTGGAGACCTCCAGGG No data
1165369504_1165369516 30 Left 1165369504 19:35395741-35395763 CCAAGTGAGAGCAGATAAGGCAG No data
Right 1165369516 19:35395794-35395816 AGGGTCACTGTGAGGGTGGCTGG No data
1165369504_1165369514 26 Left 1165369504 19:35395741-35395763 CCAAGTGAGAGCAGATAAGGCAG No data
Right 1165369514 19:35395790-35395812 CTCCAGGGTCACTGTGAGGGTGG No data
1165369504_1165369507 -1 Left 1165369504 19:35395741-35395763 CCAAGTGAGAGCAGATAAGGCAG No data
Right 1165369507 19:35395763-35395785 GCACAGGGATTCAAGCTGCCTGG No data
1165369504_1165369512 23 Left 1165369504 19:35395741-35395763 CCAAGTGAGAGCAGATAAGGCAG No data
Right 1165369512 19:35395787-35395809 GACCTCCAGGGTCACTGTGAGGG No data
1165369504_1165369508 10 Left 1165369504 19:35395741-35395763 CCAAGTGAGAGCAGATAAGGCAG No data
Right 1165369508 19:35395774-35395796 CAAGCTGCCTGGAGACCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165369504 Original CRISPR CTGCCTTATCTGCTCTCACT TGG (reversed) Intergenic
No off target data available for this crispr