ID: 1165369507

View in Genome Browser
Species Human (GRCh38)
Location 19:35395763-35395785
Sequence GCACAGGGATTCAAGCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165369504_1165369507 -1 Left 1165369504 19:35395741-35395763 CCAAGTGAGAGCAGATAAGGCAG No data
Right 1165369507 19:35395763-35395785 GCACAGGGATTCAAGCTGCCTGG No data
1165369501_1165369507 21 Left 1165369501 19:35395719-35395741 CCATTCAGCACCTTGATTCTGAC No data
Right 1165369507 19:35395763-35395785 GCACAGGGATTCAAGCTGCCTGG No data
1165369502_1165369507 11 Left 1165369502 19:35395729-35395751 CCTTGATTCTGACCAAGTGAGAG No data
Right 1165369507 19:35395763-35395785 GCACAGGGATTCAAGCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165369507 Original CRISPR GCACAGGGATTCAAGCTGCC TGG Intergenic
No off target data available for this crispr