ID: 1165369510

View in Genome Browser
Species Human (GRCh38)
Location 19:35395781-35395803
Sequence CAGTGACCCTGGAGGTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165369510_1165369517 -2 Left 1165369510 19:35395781-35395803 CCTGGAGACCTCCAGGGTCACTG No data
Right 1165369517 19:35395802-35395824 TGTGAGGGTGGCTGGAATCATGG No data
1165369510_1165369519 27 Left 1165369510 19:35395781-35395803 CCTGGAGACCTCCAGGGTCACTG No data
Right 1165369519 19:35395831-35395853 ATAAATGATTTAACATGCTCAGG No data
1165369510_1165369516 -10 Left 1165369510 19:35395781-35395803 CCTGGAGACCTCCAGGGTCACTG No data
Right 1165369516 19:35395794-35395816 AGGGTCACTGTGAGGGTGGCTGG No data
1165369510_1165369518 -1 Left 1165369510 19:35395781-35395803 CCTGGAGACCTCCAGGGTCACTG No data
Right 1165369518 19:35395803-35395825 GTGAGGGTGGCTGGAATCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165369510 Original CRISPR CAGTGACCCTGGAGGTCTCC AGG (reversed) Intergenic
No off target data available for this crispr