ID: 1165369511

View in Genome Browser
Species Human (GRCh38)
Location 19:35395786-35395808
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165369504_1165369511 22 Left 1165369504 19:35395741-35395763 CCAAGTGAGAGCAGATAAGGCAG No data
Right 1165369511 19:35395786-35395808 AGACCTCCAGGGTCACTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165369511 Original CRISPR AGACCTCCAGGGTCACTGTG AGG Intergenic
No off target data available for this crispr