ID: 1165369516 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:35395794-35395816 |
Sequence | AGGGTCACTGTGAGGGTGGC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1165369510_1165369516 | -10 | Left | 1165369510 | 19:35395781-35395803 | CCTGGAGACCTCCAGGGTCACTG | No data | ||
Right | 1165369516 | 19:35395794-35395816 | AGGGTCACTGTGAGGGTGGCTGG | No data | ||||
1165369504_1165369516 | 30 | Left | 1165369504 | 19:35395741-35395763 | CCAAGTGAGAGCAGATAAGGCAG | No data | ||
Right | 1165369516 | 19:35395794-35395816 | AGGGTCACTGTGAGGGTGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1165369516 | Original CRISPR | AGGGTCACTGTGAGGGTGGC TGG | Intergenic | ||