ID: 1165369517

View in Genome Browser
Species Human (GRCh38)
Location 19:35395802-35395824
Sequence TGTGAGGGTGGCTGGAATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165369513_1165369517 -10 Left 1165369513 19:35395789-35395811 CCTCCAGGGTCACTGTGAGGGTG No data
Right 1165369517 19:35395802-35395824 TGTGAGGGTGGCTGGAATCATGG No data
1165369510_1165369517 -2 Left 1165369510 19:35395781-35395803 CCTGGAGACCTCCAGGGTCACTG No data
Right 1165369517 19:35395802-35395824 TGTGAGGGTGGCTGGAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165369517 Original CRISPR TGTGAGGGTGGCTGGAATCA TGG Intergenic
No off target data available for this crispr