ID: 1165369518

View in Genome Browser
Species Human (GRCh38)
Location 19:35395803-35395825
Sequence GTGAGGGTGGCTGGAATCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165369513_1165369518 -9 Left 1165369513 19:35395789-35395811 CCTCCAGGGTCACTGTGAGGGTG No data
Right 1165369518 19:35395803-35395825 GTGAGGGTGGCTGGAATCATGGG No data
1165369510_1165369518 -1 Left 1165369510 19:35395781-35395803 CCTGGAGACCTCCAGGGTCACTG No data
Right 1165369518 19:35395803-35395825 GTGAGGGTGGCTGGAATCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165369518 Original CRISPR GTGAGGGTGGCTGGAATCAT GGG Intergenic
No off target data available for this crispr