ID: 1165369669

View in Genome Browser
Species Human (GRCh38)
Location 19:35396899-35396921
Sequence TTGGCTAAACGCAGGCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165369669_1165369680 26 Left 1165369669 19:35396899-35396921 CCCTGATGCCTGCGTTTAGCCAA No data
Right 1165369680 19:35396948-35396970 ATCTGAGGCTAATGGCACAAAGG No data
1165369669_1165369679 18 Left 1165369669 19:35396899-35396921 CCCTGATGCCTGCGTTTAGCCAA No data
Right 1165369679 19:35396940-35396962 AATTCTGAATCTGAGGCTAATGG No data
1165369669_1165369675 11 Left 1165369669 19:35396899-35396921 CCCTGATGCCTGCGTTTAGCCAA No data
Right 1165369675 19:35396933-35396955 TGCCCCAAATTCTGAATCTGAGG No data
1165369669_1165369681 29 Left 1165369669 19:35396899-35396921 CCCTGATGCCTGCGTTTAGCCAA No data
Right 1165369681 19:35396951-35396973 TGAGGCTAATGGCACAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165369669 Original CRISPR TTGGCTAAACGCAGGCATCA GGG (reversed) Intergenic
No off target data available for this crispr