ID: 1165370180

View in Genome Browser
Species Human (GRCh38)
Location 19:35400456-35400478
Sequence TTGCCCAGGCTGGAGTACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 689364
Summary {0: 5271, 1: 80003, 2: 189475, 3: 231508, 4: 183107}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165370180_1165370183 3 Left 1165370180 19:35400456-35400478 CCACTGTACTCCAGCCTGGGCAA 0: 5271
1: 80003
2: 189475
3: 231508
4: 183107
Right 1165370183 19:35400482-35400504 AGTGAGATCCTGTGAAACAAAGG No data
1165370180_1165370187 25 Left 1165370180 19:35400456-35400478 CCACTGTACTCCAGCCTGGGCAA 0: 5271
1: 80003
2: 189475
3: 231508
4: 183107
Right 1165370187 19:35400504-35400526 GAAAGAAAAAAGAAGGAAGGAGG No data
1165370180_1165370189 30 Left 1165370180 19:35400456-35400478 CCACTGTACTCCAGCCTGGGCAA 0: 5271
1: 80003
2: 189475
3: 231508
4: 183107
Right 1165370189 19:35400509-35400531 AAAAAAGAAGGAAGGAGGGAAGG No data
1165370180_1165370188 26 Left 1165370180 19:35400456-35400478 CCACTGTACTCCAGCCTGGGCAA 0: 5271
1: 80003
2: 189475
3: 231508
4: 183107
Right 1165370188 19:35400505-35400527 AAAGAAAAAAGAAGGAAGGAGGG 0: 44
1: 425
2: 2171
3: 8409
4: 27725
1165370180_1165370186 22 Left 1165370180 19:35400456-35400478 CCACTGTACTCCAGCCTGGGCAA 0: 5271
1: 80003
2: 189475
3: 231508
4: 183107
Right 1165370186 19:35400501-35400523 AAGGAAAGAAAAAAGAAGGAAGG No data
1165370180_1165370185 18 Left 1165370180 19:35400456-35400478 CCACTGTACTCCAGCCTGGGCAA 0: 5271
1: 80003
2: 189475
3: 231508
4: 183107
Right 1165370185 19:35400497-35400519 AACAAAGGAAAGAAAAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165370180 Original CRISPR TTGCCCAGGCTGGAGTACAG TGG (reversed) Intergenic
Too many off-targets to display for this crispr