ID: 1165370181

View in Genome Browser
Species Human (GRCh38)
Location 19:35400466-35400488
Sequence TCTCACTGTGTTGCCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 701360
Summary {0: 3138, 1: 40460, 2: 101153, 3: 213792, 4: 342817}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165370181_1165370190 24 Left 1165370181 19:35400466-35400488 CCAGCCTGGGCAACACAGTGAGA 0: 3138
1: 40460
2: 101153
3: 213792
4: 342817
Right 1165370190 19:35400513-35400535 AAGAAGGAAGGAGGGAAGGAAGG 0: 82
1: 3364
2: 43229
3: 37179
4: 50953
1165370181_1165370188 16 Left 1165370181 19:35400466-35400488 CCAGCCTGGGCAACACAGTGAGA 0: 3138
1: 40460
2: 101153
3: 213792
4: 342817
Right 1165370188 19:35400505-35400527 AAAGAAAAAAGAAGGAAGGAGGG 0: 44
1: 425
2: 2171
3: 8409
4: 27725
1165370181_1165370189 20 Left 1165370181 19:35400466-35400488 CCAGCCTGGGCAACACAGTGAGA 0: 3138
1: 40460
2: 101153
3: 213792
4: 342817
Right 1165370189 19:35400509-35400531 AAAAAAGAAGGAAGGAGGGAAGG No data
1165370181_1165370185 8 Left 1165370181 19:35400466-35400488 CCAGCCTGGGCAACACAGTGAGA 0: 3138
1: 40460
2: 101153
3: 213792
4: 342817
Right 1165370185 19:35400497-35400519 AACAAAGGAAAGAAAAAAGAAGG No data
1165370181_1165370186 12 Left 1165370181 19:35400466-35400488 CCAGCCTGGGCAACACAGTGAGA 0: 3138
1: 40460
2: 101153
3: 213792
4: 342817
Right 1165370186 19:35400501-35400523 AAGGAAAGAAAAAAGAAGGAAGG No data
1165370181_1165370187 15 Left 1165370181 19:35400466-35400488 CCAGCCTGGGCAACACAGTGAGA 0: 3138
1: 40460
2: 101153
3: 213792
4: 342817
Right 1165370187 19:35400504-35400526 GAAAGAAAAAAGAAGGAAGGAGG No data
1165370181_1165370191 28 Left 1165370181 19:35400466-35400488 CCAGCCTGGGCAACACAGTGAGA 0: 3138
1: 40460
2: 101153
3: 213792
4: 342817
Right 1165370191 19:35400517-35400539 AGGAAGGAGGGAAGGAAGGAAGG 0: 784
1: 36986
2: 30380
3: 40245
4: 57685
1165370181_1165370183 -7 Left 1165370181 19:35400466-35400488 CCAGCCTGGGCAACACAGTGAGA 0: 3138
1: 40460
2: 101153
3: 213792
4: 342817
Right 1165370183 19:35400482-35400504 AGTGAGATCCTGTGAAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165370181 Original CRISPR TCTCACTGTGTTGCCCAGGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr