ID: 1165370182

View in Genome Browser
Species Human (GRCh38)
Location 19:35400470-35400492
Sequence AGGATCTCACTGTGTTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195541
Summary {0: 122, 1: 2484, 2: 16445, 3: 51376, 4: 125114}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165370182_1165370186 8 Left 1165370182 19:35400470-35400492 CCTGGGCAACACAGTGAGATCCT 0: 122
1: 2484
2: 16445
3: 51376
4: 125114
Right 1165370186 19:35400501-35400523 AAGGAAAGAAAAAAGAAGGAAGG No data
1165370182_1165370185 4 Left 1165370182 19:35400470-35400492 CCTGGGCAACACAGTGAGATCCT 0: 122
1: 2484
2: 16445
3: 51376
4: 125114
Right 1165370185 19:35400497-35400519 AACAAAGGAAAGAAAAAAGAAGG No data
1165370182_1165370187 11 Left 1165370182 19:35400470-35400492 CCTGGGCAACACAGTGAGATCCT 0: 122
1: 2484
2: 16445
3: 51376
4: 125114
Right 1165370187 19:35400504-35400526 GAAAGAAAAAAGAAGGAAGGAGG No data
1165370182_1165370188 12 Left 1165370182 19:35400470-35400492 CCTGGGCAACACAGTGAGATCCT 0: 122
1: 2484
2: 16445
3: 51376
4: 125114
Right 1165370188 19:35400505-35400527 AAAGAAAAAAGAAGGAAGGAGGG 0: 44
1: 425
2: 2171
3: 8409
4: 27725
1165370182_1165370189 16 Left 1165370182 19:35400470-35400492 CCTGGGCAACACAGTGAGATCCT 0: 122
1: 2484
2: 16445
3: 51376
4: 125114
Right 1165370189 19:35400509-35400531 AAAAAAGAAGGAAGGAGGGAAGG No data
1165370182_1165370191 24 Left 1165370182 19:35400470-35400492 CCTGGGCAACACAGTGAGATCCT 0: 122
1: 2484
2: 16445
3: 51376
4: 125114
Right 1165370191 19:35400517-35400539 AGGAAGGAGGGAAGGAAGGAAGG 0: 784
1: 36986
2: 30380
3: 40245
4: 57685
1165370182_1165370190 20 Left 1165370182 19:35400470-35400492 CCTGGGCAACACAGTGAGATCCT 0: 122
1: 2484
2: 16445
3: 51376
4: 125114
Right 1165370190 19:35400513-35400535 AAGAAGGAAGGAGGGAAGGAAGG 0: 82
1: 3364
2: 43229
3: 37179
4: 50953

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165370182 Original CRISPR AGGATCTCACTGTGTTGCCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr