ID: 1165370184

View in Genome Browser
Species Human (GRCh38)
Location 19:35400490-35400512
Sequence TTTTCTTTCCTTTGTTTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165370184_1165370189 -4 Left 1165370184 19:35400490-35400512 CCTGTGAAACAAAGGAAAGAAAA No data
Right 1165370189 19:35400509-35400531 AAAAAAGAAGGAAGGAGGGAAGG No data
1165370184_1165370190 0 Left 1165370184 19:35400490-35400512 CCTGTGAAACAAAGGAAAGAAAA No data
Right 1165370190 19:35400513-35400535 AAGAAGGAAGGAGGGAAGGAAGG 0: 82
1: 3364
2: 43229
3: 37179
4: 50953
1165370184_1165370187 -9 Left 1165370184 19:35400490-35400512 CCTGTGAAACAAAGGAAAGAAAA No data
Right 1165370187 19:35400504-35400526 GAAAGAAAAAAGAAGGAAGGAGG No data
1165370184_1165370191 4 Left 1165370184 19:35400490-35400512 CCTGTGAAACAAAGGAAAGAAAA No data
Right 1165370191 19:35400517-35400539 AGGAAGGAGGGAAGGAAGGAAGG 0: 784
1: 36986
2: 30380
3: 40245
4: 57685
1165370184_1165370188 -8 Left 1165370184 19:35400490-35400512 CCTGTGAAACAAAGGAAAGAAAA No data
Right 1165370188 19:35400505-35400527 AAAGAAAAAAGAAGGAAGGAGGG 0: 44
1: 425
2: 2171
3: 8409
4: 27725

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165370184 Original CRISPR TTTTCTTTCCTTTGTTTCAC AGG (reversed) Intergenic
No off target data available for this crispr