ID: 1165370187

View in Genome Browser
Species Human (GRCh38)
Location 19:35400504-35400526
Sequence GAAAGAAAAAAGAAGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165370184_1165370187 -9 Left 1165370184 19:35400490-35400512 CCTGTGAAACAAAGGAAAGAAAA No data
Right 1165370187 19:35400504-35400526 GAAAGAAAAAAGAAGGAAGGAGG No data
1165370182_1165370187 11 Left 1165370182 19:35400470-35400492 CCTGGGCAACACAGTGAGATCCT 0: 122
1: 2484
2: 16445
3: 51376
4: 125114
Right 1165370187 19:35400504-35400526 GAAAGAAAAAAGAAGGAAGGAGG No data
1165370181_1165370187 15 Left 1165370181 19:35400466-35400488 CCAGCCTGGGCAACACAGTGAGA 0: 3138
1: 40460
2: 101153
3: 213792
4: 342817
Right 1165370187 19:35400504-35400526 GAAAGAAAAAAGAAGGAAGGAGG No data
1165370180_1165370187 25 Left 1165370180 19:35400456-35400478 CCACTGTACTCCAGCCTGGGCAA 0: 5271
1: 80003
2: 189475
3: 231508
4: 183107
Right 1165370187 19:35400504-35400526 GAAAGAAAAAAGAAGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165370187 Original CRISPR GAAAGAAAAAAGAAGGAAGG AGG Intergenic
No off target data available for this crispr