ID: 1165371695

View in Genome Browser
Species Human (GRCh38)
Location 19:35411639-35411661
Sequence GTGTGGTATTAAAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165371695_1165371704 24 Left 1165371695 19:35411639-35411661 CCTTCTTCCCTTTAATACCACAC No data
Right 1165371704 19:35411686-35411708 GCTTCGAACTATGTGAATCTAGG No data
1165371695_1165371705 25 Left 1165371695 19:35411639-35411661 CCTTCTTCCCTTTAATACCACAC No data
Right 1165371705 19:35411687-35411709 CTTCGAACTATGTGAATCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165371695 Original CRISPR GTGTGGTATTAAAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr