ID: 1165374336

View in Genome Browser
Species Human (GRCh38)
Location 19:35431249-35431271
Sequence GAGGGAAAACACATGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165374336_1165374351 15 Left 1165374336 19:35431249-35431271 CCCTGCACCATGTGTTTTCCCTC No data
Right 1165374351 19:35431287-35431309 CAGCTGTCACGTCTCTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165374336 Original CRISPR GAGGGAAAACACATGGTGCA GGG (reversed) Intergenic
No off target data available for this crispr