ID: 1165376581

View in Genome Browser
Species Human (GRCh38)
Location 19:35447179-35447201
Sequence CCACATGGGCACGTGAACTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165376574_1165376581 -5 Left 1165376574 19:35447161-35447183 CCACTCCCTGACGAAAAGCCACA 0: 1
1: 0
2: 2
3: 16
4: 149
Right 1165376581 19:35447179-35447201 CCACATGGGCACGTGAACTCGGG 0: 1
1: 0
2: 0
3: 3
4: 98
1165376577_1165376581 -10 Left 1165376577 19:35447166-35447188 CCCTGACGAAAAGCCACATGGGC 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1165376581 19:35447179-35447201 CCACATGGGCACGTGAACTCGGG 0: 1
1: 0
2: 0
3: 3
4: 98
1165376573_1165376581 3 Left 1165376573 19:35447153-35447175 CCTGAGTGCCACTCCCTGACGAA 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1165376581 19:35447179-35447201 CCACATGGGCACGTGAACTCGGG 0: 1
1: 0
2: 0
3: 3
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165376581 Original CRISPR CCACATGGGCACGTGAACTC GGG Intronic
903929851 1:26855919-26855941 CCCCATGGGCACGTGAAAAGAGG + Exonic
907311841 1:53543254-53543276 CCTCATGGGGACGTGGACACGGG + Intronic
909520481 1:76562599-76562621 CCACATAGGCAGGCCAACTCAGG - Intronic
914716222 1:150257205-150257227 CCACACAGGCACGTGGACCCAGG + Exonic
917117924 1:171621146-171621168 CAACTTGGGCACGTGTTCTCAGG + Intergenic
918707390 1:187683246-187683268 CCAGATGGGTAAGTGACCTCGGG + Intergenic
924836082 1:247649168-247649190 CTACCTGGGCACGTGTTCTCAGG - Intergenic
1063523071 10:6758499-6758521 CCACATGGGCAGGTAGCCTCAGG - Intergenic
1063534894 10:6873852-6873874 GCACATGCGCAAGGGAACTCAGG + Intergenic
1067222683 10:44355450-44355472 CCAGATGGGCAAGTGACCTTTGG - Intergenic
1070394963 10:76003934-76003956 CCACCTGGGCTAGAGAACTCTGG - Intronic
1071830039 10:89362560-89362582 TCACATGGGCAGGTGACCTGGGG + Intronic
1073489503 10:103843655-103843677 TCACATGGGCAGGTGACCTGGGG + Intronic
1080823774 11:35830850-35830872 CCTCATGGCCATGGGAACTCTGG - Intergenic
1081573960 11:44308139-44308161 CCACATGGGCATGTGTTCTTGGG + Intronic
1083548196 11:63564564-63564586 CCACATGACCACGTGAGCTGAGG - Intergenic
1086582427 11:88414597-88414619 CCACATGTGAACCTGAACCCTGG + Intergenic
1087076635 11:94131923-94131945 CCATATTGGCCAGTGAACTCAGG + Intronic
1087401522 11:97672719-97672741 ACACATGGGCAGATGAACTCGGG + Intergenic
1088991771 11:114960303-114960325 CCACATGGGCTGCTGAACTAGGG + Intergenic
1090904807 11:131065828-131065850 CCACATGGCAACGTGACCTGAGG - Intergenic
1097400198 12:59119103-59119125 CCACCTGGGCACATGTTCTCAGG + Intergenic
1097558433 12:61169951-61169973 TCACAGGTGCAGGTGAACTCAGG - Intergenic
1103037656 12:117669438-117669460 CCACATGAGCACTTGAATTGTGG + Intronic
1103629201 12:122246057-122246079 CCACATGTGCTCATGAACTACGG + Intronic
1104799006 12:131540663-131540685 CCACATGTGCACAATAACTCAGG + Intergenic
1129362114 15:75030437-75030459 CCACAAGAGCAGGTGAACTGTGG - Intronic
1136273057 16:29159717-29159739 CCAGATGGGCCCTTGAAGTCTGG + Intergenic
1142076606 16:88121519-88121541 CCAGATGGGCCCTTGAAGTCTGG + Intergenic
1143091935 17:4454117-4454139 CCAAGTGGGAACGTGAATTCTGG - Intronic
1147382676 17:40064825-40064847 GCACATGGTCCCCTGAACTCAGG + Intronic
1152364560 17:79847910-79847932 GCACAGGGGCAGGTGGACTCTGG - Intergenic
1160463092 18:79054245-79054267 CCACATAGGGAAGGGAACTCAGG + Intergenic
1163263426 19:16204713-16204735 CCACATGGGAATGTGCACACCGG - Intronic
1164579772 19:29427627-29427649 CCAGATGGGAAAGTGAACTGTGG + Intergenic
1165161894 19:33821173-33821195 CCACCTGGGCATGGGAACTGGGG - Intergenic
1165376581 19:35447179-35447201 CCACATGGGCACGTGAACTCGGG + Intronic
925238929 2:2304901-2304923 CCACATGGGCTCTTGAGCCCTGG + Intronic
925909664 2:8565576-8565598 CCAGATGGGCACCTGAGCTGTGG - Intergenic
925976293 2:9144373-9144395 CCACTTGGGTACATGACCTCAGG - Intergenic
929808286 2:45167909-45167931 GCACATGGGCATTTTAACTCAGG + Intergenic
932873861 2:75430669-75430691 CCCCTTGGGCACGTGTTCTCAGG - Intergenic
933671364 2:85010569-85010591 CCACATGAGCACTTGAAATGTGG + Intronic
934516427 2:94990889-94990911 CCACATGGGCTGGTAATCTCCGG - Intergenic
938317296 2:130339056-130339078 CGACATGGCTACGTGATCTCAGG - Exonic
942098333 2:172554966-172554988 CCCCTTGGGCACGTGTTCTCAGG + Intergenic
946934998 2:224710758-224710780 CCACATAAGAAGGTGAACTCTGG - Intergenic
1174143482 20:48433746-48433768 CCCCTTGGGCACGTGTTCTCAGG + Intergenic
1175839820 20:62019860-62019882 CCACACGGGCACCTGCACCCTGG + Intronic
1181236122 22:21448640-21448662 CCACTTGGGTCCCTGAACTCAGG - Exonic
1181942824 22:26492006-26492028 CGACATGGCCAAGTGAACTGTGG - Exonic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1185068804 22:48645136-48645158 CCACATGGGCACCTGCTCCCTGG - Intronic
949318280 3:2781560-2781582 CCACTTGGGCACATGTTCTCAGG - Intronic
953117603 3:40008696-40008718 CCACATGGCCACTCGACCTCAGG + Intronic
958270707 3:91495798-91495820 CCACAGGGGGAGGTGAACTTGGG + Intergenic
960425898 3:117507658-117507680 CCACCTGGGCACATGTTCTCAGG - Intergenic
961344181 3:126251156-126251178 CCCCATGGGCACATGTTCTCAGG + Intergenic
961652258 3:128422464-128422486 CCACATGGGCCCTTGTACTGGGG + Intergenic
962873777 3:139520034-139520056 TCACATGGGGACATTAACTCAGG + Intronic
962971136 3:140403176-140403198 CCACAGGGGCTCTGGAACTCTGG + Intronic
965920275 3:173905131-173905153 CCACATGGGAAAGAGAACTCAGG - Intronic
968580907 4:1394551-1394573 CCACATGGGCACGTGTGAGCAGG - Exonic
968580929 4:1394673-1394695 CCACATGGGCACGTGTGAGCAGG - Exonic
968580990 4:1395013-1395035 CCACATGGGCACGTGTGAGCAGG - Exonic
968581001 4:1395075-1395097 CCACATGGGCACGTGTGATCAGG - Exonic
968581009 4:1395137-1395159 CCACATGGGCACGTGTGAGCAGG - Exonic
968581023 4:1395230-1395252 CCACATGGGCACGTGTGAGCAGG - Exonic
968581034 4:1395290-1395312 CCACATGGGCACGTGTGAGCAGG - Exonic
968581052 4:1395381-1395403 CCACATGGGCACGTGTGAGCAGG - Exonic
968581079 4:1395536-1395558 CCACATGGGCACGTGTGAGCAGG - Exonic
968581085 4:1395567-1395589 CCACATGGGCACGTGTGAGCAGG - Exonic
968581097 4:1395631-1395653 CCACATGGGCACGTGTGAGCAGG - Exonic
969289815 4:6231300-6231322 CAACCTGGGCACTTGGACTCTGG - Intergenic
973541687 4:51941531-51941553 GCACATGGCCAGGTGAACCCAGG - Intergenic
976645095 4:87379182-87379204 CAACATGGTCACCTGAAGTCAGG - Intronic
979284725 4:118909526-118909548 CCACATTAGCACCTGGACTCTGG - Intronic
984188973 4:176582176-176582198 TCACATGGGTACGTGAAGTATGG - Intergenic
985672052 5:1212161-1212183 CCACACGTGCACATGAACACAGG - Intronic
985898476 5:2765174-2765196 CCACATCAGCACCTGCACTCTGG + Intergenic
996806603 5:127462457-127462479 CCACTTGGACTCGTGAACTGAGG + Intronic
1000013295 5:157253932-157253954 CCTCATGGGGATGTGAACCCAGG - Exonic
1021673603 7:23058177-23058199 CACCTTGGGCACGTGTACTCAGG + Intergenic
1026129960 7:67612114-67612136 CCTCATGGGTAAGTGGACTCTGG - Intergenic
1033497672 7:141916091-141916113 CCACAGGGCCACGTGGAATCAGG + Intronic
1034881889 7:154768969-154768991 CCAAATGAGAAAGTGAACTCTGG - Intronic
1037492393 8:19408561-19408583 CTACATGGGCCCGTGGCCTCTGG + Intronic
1038447638 8:27614959-27614981 CCAGATGGGCACGCGAGTTCAGG - Exonic
1041702884 8:60810952-60810974 TCTCATAGGAACGTGAACTCTGG + Intronic
1042410263 8:68458330-68458352 CCACATGGGCACGTCAGGTGAGG - Intronic
1044193259 8:89344170-89344192 CCATATGGGCAAGAGAATTCTGG + Intergenic
1045142582 8:99302842-99302864 CTCCATGGGCACGTGAAGTACGG + Intronic
1045256702 8:100531002-100531024 CCACTGGCGCACCTGAACTCAGG + Intronic
1046691112 8:117285671-117285693 GCACATGTGTATGTGAACTCTGG - Intergenic
1049452329 8:142668992-142669014 CCCCAAGGCCACGTGAACACGGG + Intronic
1054730072 9:68692675-68692697 CCACATGTGCACTTGAAATGTGG - Intergenic
1057125683 9:92614201-92614223 TCACATGTGCACTTGAACCCAGG + Exonic
1189322002 X:40092377-40092399 CCAGACGCGCACGTAAACTCCGG - Intronic
1190107298 X:47569684-47569706 GCACATGGGGACGTGGGCTCCGG + Intronic
1190687457 X:52887722-52887744 CCTCCTGGGCAAGTGCACTCAGG - Intergenic
1190698525 X:52968070-52968092 CCTCCTGGGCAAGTGCACTCAGG + Intronic
1200957840 Y:8969835-8969857 CCAGATAGGCCCCTGAACTCTGG - Intergenic