ID: 1165376704

View in Genome Browser
Species Human (GRCh38)
Location 19:35448194-35448216
Sequence CCACGTGACCAGAGAAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165376704_1165376708 11 Left 1165376704 19:35448194-35448216 CCTTCCTTTCTCTGGTCACGTGG 0: 1
1: 0
2: 1
3: 6
4: 166
Right 1165376708 19:35448228-35448250 ATAAATGCTTACTACCAGCCAGG 0: 1
1: 0
2: 0
3: 23
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165376704 Original CRISPR CCACGTGACCAGAGAAAGGA AGG (reversed) Intronic
900945331 1:5828075-5828097 CCACGTGAACTGAGAGTGGAGGG + Intergenic
901041633 1:6367753-6367775 CCACGTTGCCAGTGAAGGGAAGG - Intronic
901652087 1:10748831-10748853 CCACGTGGCCAGAGCAAGCATGG + Intronic
902478983 1:16701890-16701912 CCACAGGAACAGAGCAAGGATGG - Intergenic
902781220 1:18706133-18706155 CCACCTGCCCAGAGTGAGGAGGG - Intronic
902852172 1:19168044-19168066 CAACCTGACCAGTGAGAGGAGGG + Exonic
904001193 1:27339733-27339755 ACAGGAGAGCAGAGAAAGGAAGG + Intergenic
906496085 1:46304912-46304934 CCAAGTGACCAGAGAACAGACGG - Intronic
915042469 1:152980694-152980716 CAAGGTGATCAGAGAAAGGGAGG + Intergenic
916674292 1:167053383-167053405 CAAGGAGACCAGAGAAGGGAAGG + Exonic
916988257 1:170214691-170214713 CAAGGAGACAAGAGAAAGGAAGG + Intergenic
917537672 1:175886172-175886194 CCACTAGGCCAGAGAAAGGTGGG - Intergenic
918566218 1:185936469-185936491 TCATGTGAACAGAAAAAGGATGG - Intronic
919967086 1:202538621-202538643 CCAAGAGTCCAGAGAAAAGAGGG + Intronic
920309770 1:205042161-205042183 CCACGTGACCGGAGCAGGGCAGG + Intergenic
920350656 1:205335874-205335896 CCAAGTACCCAGAGAAAGGGAGG + Intergenic
920836130 1:209512854-209512876 CCAGATGAGCAGAGAAAGGCTGG + Intergenic
922969936 1:229727754-229727776 CCAGGTGACCAGACGGAGGAGGG + Intergenic
923261013 1:232268099-232268121 CAATGTGATCAAAGAAAGGAAGG - Intergenic
1063241895 10:4178723-4178745 CCATTTGACAACAGAAAGGAGGG + Intergenic
1064120008 10:12610383-12610405 GAATGTGCCCAGAGAAAGGAGGG - Intronic
1064792086 10:18969258-18969280 TCACTTAACCAGAGAAATGAAGG + Intergenic
1075537026 10:123279821-123279843 TCCCGTGACCAAAGAAAAGATGG - Intergenic
1077149342 11:1062507-1062529 CCAGGAGCACAGAGAAAGGATGG - Intergenic
1079130843 11:17746135-17746157 CCACGTGAGGCCAGAAAGGAAGG - Intronic
1080451591 11:32382688-32382710 TCAAGTGCCTAGAGAAAGGACGG - Intergenic
1085891862 11:80589133-80589155 CCCTGTTAACAGAGAAAGGAAGG - Intergenic
1087982706 11:104635931-104635953 CCATGTGATCAGAGGAAAGATGG - Intergenic
1089556390 11:119317778-119317800 GCCTTTGACCAGAGAAAGGAAGG + Intronic
1090265745 11:125351808-125351830 CCAAGTGACCCGAGAATGGGGGG - Intronic
1090421404 11:126577786-126577808 CGTCTAGACCAGAGAAAGGACGG - Intronic
1094063028 12:26334718-26334740 CCAGTTGACCAGGCAAAGGAAGG + Intergenic
1094466859 12:30762592-30762614 CCACCAGAACATAGAAAGGAGGG + Intergenic
1096658515 12:53106372-53106394 CCTAGTGGCCAGAGAAATGAGGG + Intronic
1096817621 12:54211269-54211291 CCAAGTGAGCAGTGGAAGGAAGG + Intergenic
1101983220 12:109425739-109425761 CCACGTGACCAGACCAAGACTGG + Intronic
1101990669 12:109481905-109481927 CCACTTGACCACAGGAGGGAAGG - Intronic
1104171614 12:126287028-126287050 TCACATGGCGAGAGAAAGGAAGG + Intergenic
1104934677 12:132358106-132358128 CCACGTGGCCACAGAGATGACGG + Intergenic
1109803919 13:67412619-67412641 CCAAGTGATCAGAAATAGGATGG + Intergenic
1113150465 13:107257727-107257749 TCATGTGACCACAGAAAGGCTGG + Intronic
1116484228 14:45427644-45427666 CCATGGGACCAGGGAAAAGAGGG + Intergenic
1117171030 14:53096172-53096194 CCATTTGAACAGAGAAGGGAGGG + Intronic
1118638169 14:67767037-67767059 CTAGTGGACCAGAGAAAGGAGGG - Intronic
1119935132 14:78585381-78585403 CCAAGGGGCCAGAGAATGGAAGG + Intronic
1120861548 14:89259385-89259407 CCTAGTGACCAGAGCAAAGAGGG - Intronic
1122940820 14:104980605-104980627 CCAGGTGACCAGAGCAGGGTGGG - Intergenic
1122960696 14:105092567-105092589 CCAGGAGTCCAGATAAAGGAGGG + Intergenic
1124515109 15:30361193-30361215 CCAGGTATCCAGAGAAGGGATGG + Intergenic
1124727813 15:32169534-32169556 CCAGGTATCCAGAGAAGGGATGG - Intronic
1129698004 15:77751614-77751636 CCAAGTGATCAGAGGAGGGAGGG - Intronic
1130219534 15:82007601-82007623 CAAAGAGATCAGAGAAAGGAAGG - Intergenic
1132694061 16:1194380-1194402 CCAGGGAACCAGAGGAAGGAGGG - Intronic
1133768898 16:8856369-8856391 CCTCGTGACCAGATCAAAGAGGG - Intronic
1135722101 16:24826816-24826838 CCAGGGGAGCAGAGCAAGGAGGG - Intronic
1137282057 16:46985464-46985486 CCACTTGAACAGAGAAATTAAGG + Intergenic
1138245600 16:55464771-55464793 CCACGTGCCAAGAGCGAGGAGGG + Intronic
1141212637 16:81995388-81995410 TCTCCTGACCATAGAAAGGAAGG + Exonic
1141432073 16:83975446-83975468 TCACGTGTCCACAGGAAGGATGG + Intronic
1142737057 17:1907741-1907763 CCACGTGCCAAGACAGAGGAAGG + Intergenic
1146127048 17:30238145-30238167 CCACCCGGCCAGAGAGAGGAGGG - Intergenic
1146672470 17:34751022-34751044 CCACCTGACAAGACATAGGAAGG - Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151414531 17:73952778-73952800 CCACGCGGACAGAGCAAGGAGGG - Intergenic
1155890480 18:31262032-31262054 CCACATGCCCAGAGCCAGGAGGG + Intergenic
1157523360 18:48360702-48360724 CCAAGTGACCAGCCAAAGGCAGG + Intronic
1157899724 18:51503051-51503073 CAAAGTGACCAGGGAAAGTATGG + Intergenic
1160116221 18:76081837-76081859 ACACGTGGCCACAGAAATGAGGG + Intergenic
1160244654 18:77147475-77147497 CCATGAAACCAGAAAAAGGAAGG - Intergenic
1161947943 19:7450062-7450084 CCTGGTGAGCTGAGAAAGGAAGG + Intronic
1162859223 19:13492982-13493004 CCAGGAGACCAAAGAAAGTAAGG + Intronic
1165376704 19:35448194-35448216 CCACGTGACCAGAGAAAGGAAGG - Intronic
1165484306 19:36086216-36086238 GCAAGTGACCAGAGTAGGGAAGG + Intronic
1166982523 19:46639514-46639536 CAACGGGGCCAGATAAAGGAGGG + Intergenic
1167422737 19:49413640-49413662 CTGCGTCACCAGAGAAAGGAGGG + Intronic
1168098045 19:54126596-54126618 CCACGAGAGCACAGAAGGGAAGG + Exonic
1202713024 1_KI270714v1_random:27797-27819 CCACAGGAACAGAGCAAGGATGG - Intergenic
927425663 2:22978789-22978811 CCAAGGGACCAGAGAAAGTGAGG - Intergenic
930702739 2:54475438-54475460 CCATGTGACCACAGAGAGAAGGG - Intronic
934541053 2:95175424-95175446 CCACGGGACCAGAGGCAGGCAGG - Intronic
938092590 2:128443134-128443156 CCACCTCAGCAGAGAAGGGAAGG - Intergenic
938232741 2:129675578-129675600 CCCAGTGAACAGAGAGAGGAAGG - Intergenic
938320102 2:130356586-130356608 CCCTGTGACCACAGGAAGGAAGG + Intronic
943812766 2:192210024-192210046 CCAAGTAACCAGAGAATGGGTGG + Intergenic
946425359 2:219592276-219592298 ACACATGGCCAGAGAGAGGAGGG - Intergenic
947553585 2:231066974-231066996 CCAATTGACCAGAGATTGGAAGG + Exonic
1168972662 20:1941463-1941485 CCACCTTCCCAGAGAATGGAAGG - Intergenic
1170338442 20:15296993-15297015 CCAGGGGACCAGGGAAATGAAGG - Intronic
1173164264 20:40675410-40675432 CCATGTCAACAGAGAAAGGAAGG + Intergenic
1173978830 20:47207502-47207524 CCTGAAGACCAGAGAAAGGAGGG - Intergenic
1174666761 20:52265287-52265309 CCCAGAAACCAGAGAAAGGAGGG + Intergenic
1174903810 20:54528505-54528527 CTTCATGACCAGAAAAAGGAGGG + Intronic
1175173768 20:57097422-57097444 CCATGTGACCAGAGGGAGGACGG - Intergenic
1175762565 20:61571473-61571495 CCACGTGATCAGAGCACGGCAGG + Intronic
1177160849 21:17546500-17546522 CCACGTGGCCAGAGCAGAGAAGG + Intronic
1178030821 21:28523485-28523507 CCAGGTCACCAGAGAATGAAAGG + Intergenic
1179020949 21:37640481-37640503 ACACTTGACCAAGGAAAGGAAGG - Intronic
1180740630 22:18050939-18050961 CCACGTAAGCAGAGAAGAGATGG - Intergenic
1182567489 22:31211146-31211168 CCAAATGACCAGAAAGAGGATGG - Intergenic
1185148303 22:49150963-49150985 CGAGGTCACCAGAGGAAGGAGGG + Intergenic
1185418623 22:50722857-50722879 CCACATGGCCACAGAGAGGATGG - Intergenic
949901406 3:8817850-8817872 CCAGGAGTCCAGAGAAGGGAGGG + Intronic
949953853 3:9251422-9251444 CCACGTTACCTGAGAAAGATGGG + Intronic
950499546 3:13354945-13354967 CTATGTGGCCAGAGAAGGGAGGG - Intronic
953793304 3:45964855-45964877 CCAGGTGTCCAGGGAATGGATGG + Intronic
956641675 3:71421689-71421711 CCTCCTGACCAAAGAAAGGCTGG + Intronic
957898210 3:86451579-86451601 CCAAGTGACCAGTCAAAGAAAGG + Intergenic
961053673 3:123768280-123768302 CCCCCTGACCAGCAAAAGGAAGG - Intronic
961513375 3:127418145-127418167 CCTCGTGAGCACAGAAAGGCGGG + Intergenic
961760436 3:129163264-129163286 CAGTGTGAGCAGAGAAAGGAAGG - Intergenic
962653618 3:137520176-137520198 CCATGCAACCAGAGAAAGGGAGG - Intergenic
965379685 3:167972991-167973013 CCACCTGAACAGAGAAAGTTTGG + Intergenic
966103548 3:176307029-176307051 AAAAGTGATCAGAGAAAGGAAGG - Intergenic
967826447 3:193881509-193881531 CTACCTGAGCAGAGAGAGGAAGG - Intergenic
970288858 4:14549942-14549964 TAACGTGAGCAGAGAAATGAAGG - Intergenic
970621627 4:17827173-17827195 CCATGTGACTAGAGAATTGATGG + Intronic
971249981 4:24966557-24966579 CCCCCTGACAGGAGAAAGGAGGG + Intronic
971336702 4:25729772-25729794 GCACGTCACCAGAGGAAGGGTGG - Intergenic
971362509 4:25950928-25950950 CCACGTCACCTGGGAAGGGAAGG + Intergenic
972651186 4:41019312-41019334 CCACGTGATGAGAGAAGAGAAGG + Intronic
977414454 4:96714225-96714247 TCACGTAACAAGAGAAATGATGG - Intergenic
980602486 4:135042025-135042047 CCATGTGACCAGATACAGAAAGG + Intergenic
980659880 4:135843342-135843364 CCACATGACCAGTTACAGGAAGG + Intergenic
981002187 4:139838644-139838666 CCAATTTACCAGAGAAAGAATGG - Intronic
983735337 4:171051965-171051987 CCACAGGACCAGAGCAAAGATGG - Intergenic
984648032 4:182240669-182240691 CCACGAGAGCAGGGAAAGGCAGG + Intronic
986435533 5:7726579-7726601 GCACTGGACGAGAGAAAGGAAGG + Intronic
988444315 5:31268158-31268180 CCATTTGGCCAGAGAATGGATGG - Intronic
992126696 5:73649800-73649822 CCAAGTAGCCAGAGAAAAGACGG + Intronic
996272996 5:121630839-121630861 CTACTTGACAAGAGGAAGGAGGG + Intergenic
999365898 5:151023201-151023223 CCACGTGCCCAGAGAAGGGAAGG + Intronic
1000900398 5:166905153-166905175 CCACATGACCAAAGAAAGAGAGG + Intergenic
1003614355 6:7641786-7641808 CCATTTCACCAAAGAAAGGAAGG + Intergenic
1004695289 6:18027503-18027525 CCAAGTGACAAGTGCAAGGATGG - Intergenic
1004847415 6:19660661-19660683 TCATGTGACCAGAGACTGGAGGG + Intergenic
1007133217 6:39496251-39496273 CCACATGACCACAGGACGGATGG + Intronic
1009698927 6:67149082-67149104 GCACCTGAGCAGAGAGAGGAGGG + Intergenic
1012246626 6:96933351-96933373 CCACATGAACAAAGAATGGATGG - Intronic
1014792456 6:125689405-125689427 CCAAGTGACCATAGAATGGTAGG + Intergenic
1016553272 6:145306842-145306864 CCTCGTGACCAAAGAAGTGAAGG + Intergenic
1017043815 6:150328857-150328879 CCACGTGACCAGTTACAGAAAGG - Intergenic
1017569713 6:155731379-155731401 CCACAGGAACAGAGGAAGGATGG + Intergenic
1017911876 6:158800342-158800364 CCATGTCACCAAGGAAAGGAAGG + Intronic
1017912636 6:158807440-158807462 CCACAGCACCTGAGAAAGGATGG + Intronic
1019694787 7:2439225-2439247 CCACGTGACCTGAGGATGCAGGG + Intergenic
1021174679 7:17437553-17437575 CTAGGTGACCAAGGAAAGGAGGG + Intergenic
1021643223 7:22761156-22761178 CCAAAGGACCAGAGAAGGGATGG - Intergenic
1022468953 7:30670044-30670066 CTACGTTACAAGAGAAGGGAAGG - Intronic
1033631900 7:143166495-143166517 CAGTGTGACCAAAGAAAGGAAGG - Intergenic
1034860193 7:154588177-154588199 CCCAGTGACCAGGGATAGGATGG - Intronic
1034886308 7:154801646-154801668 GCACGTGACCAGATAGAGCAAGG - Intronic
1036912650 8:12770427-12770449 CCACAAGAGCAGAGCAAGGAGGG - Intergenic
1038583697 8:28771299-28771321 CCAGGTGACCAGTGGCAGGAAGG + Intronic
1039351651 8:36770133-36770155 CCATGTGGCCAGAAAGAGGAAGG + Intergenic
1040433324 8:47365244-47365266 CCAAGTGGCATGAGAAAGGATGG + Intronic
1043373346 8:79618800-79618822 CCACATGACCAGCAAAATGATGG - Intronic
1046485367 8:114880748-114880770 CCAGGTGACCCTAGAAAGTAAGG - Intergenic
1046789280 8:118304002-118304024 CCATGTGAACAGAGAATAGAGGG - Intronic
1049096674 8:140552266-140552288 CCACTTGAGAAGAGAAAGGCGGG + Intronic
1053512229 9:38697495-38697517 CCACGAAGCCAGAGAAATGAAGG - Intergenic
1055611459 9:78030391-78030413 CCACCAGACCATCGAAAGGAGGG - Intronic
1056060238 9:82877816-82877838 CCAGGTGTTCAGAAAAAGGAGGG + Intergenic
1056384538 9:86084759-86084781 CTCCGTGCCCAGCGAAAGGAAGG - Intronic
1057835903 9:98445185-98445207 CGAGGGGATCAGAGAAAGGAAGG + Intronic
1059415765 9:114161684-114161706 GCACGTGGCCAGAGACAGGCGGG - Intronic
1061071173 9:128311578-128311600 CCACGTGACCAGAGAGAAGCTGG - Exonic
1062571223 9:137186277-137186299 CCAGGTGACCCGGGAGAGGATGG - Exonic
1186904344 X:14095365-14095387 CCATGTGACCAGATATTGGAAGG - Intergenic
1188326638 X:28811539-28811561 CCACATGGTCAGATAAAGGAAGG + Intronic
1199351103 X:146802005-146802027 CCAGAAGACCAGAAAAAGGATGG + Intergenic
1199352804 X:146822488-146822510 CCAGAAGACCAGAAAAAGGATGG - Intergenic
1200091392 X:153637743-153637765 CCACCCGGCCAGAGCAAGGAAGG - Intergenic
1202302686 Y:23434384-23434406 CCAAGAGTCCAGAGAAAAGACGG + Intergenic
1202568125 Y:26236210-26236232 CCAAGAGTCCAGAGAAAAGACGG - Intergenic