ID: 1165380573

View in Genome Browser
Species Human (GRCh38)
Location 19:35476622-35476644
Sequence AGAACTTCAACAGGGTGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165380573_1165380581 9 Left 1165380573 19:35476622-35476644 CCATTTCACCCTGTTGAAGTTCT No data
Right 1165380581 19:35476654-35476676 TCCACAGTGCCGCCATTGTTGGG No data
1165380573_1165380580 8 Left 1165380573 19:35476622-35476644 CCATTTCACCCTGTTGAAGTTCT No data
Right 1165380580 19:35476653-35476675 CTCCACAGTGCCGCCATTGTTGG No data
1165380573_1165380583 10 Left 1165380573 19:35476622-35476644 CCATTTCACCCTGTTGAAGTTCT No data
Right 1165380583 19:35476655-35476677 CCACAGTGCCGCCATTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165380573 Original CRISPR AGAACTTCAACAGGGTGAAA TGG (reversed) Intergenic
No off target data available for this crispr