ID: 1165380580

View in Genome Browser
Species Human (GRCh38)
Location 19:35476653-35476675
Sequence CTCCACAGTGCCGCCATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165380573_1165380580 8 Left 1165380573 19:35476622-35476644 CCATTTCACCCTGTTGAAGTTCT No data
Right 1165380580 19:35476653-35476675 CTCCACAGTGCCGCCATTGTTGG No data
1165380577_1165380580 -1 Left 1165380577 19:35476631-35476653 CCTGTTGAAGTTCTCGGGCCGCC No data
Right 1165380580 19:35476653-35476675 CTCCACAGTGCCGCCATTGTTGG No data
1165380576_1165380580 0 Left 1165380576 19:35476630-35476652 CCCTGTTGAAGTTCTCGGGCCGC No data
Right 1165380580 19:35476653-35476675 CTCCACAGTGCCGCCATTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165380580 Original CRISPR CTCCACAGTGCCGCCATTGT TGG Intergenic
No off target data available for this crispr