ID: 1165383682

View in Genome Browser
Species Human (GRCh38)
Location 19:35497973-35497995
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1294
Summary {0: 3, 1: 32, 2: 126, 3: 364, 4: 769}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165383682_1165383686 -2 Left 1165383682 19:35497973-35497995 CCAGACAGGGTCTCCCTCTGTTG 0: 3
1: 32
2: 126
3: 364
4: 769
Right 1165383686 19:35497994-35498016 TGCCCAGACTTGGAGTGCAATGG 0: 1
1: 15
2: 132
3: 338
4: 756

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165383682 Original CRISPR CAACAGAGGGAGACCCTGTC TGG (reversed) Intronic
900248719 1:1654289-1654311 TAACAGAGCAAGACCCTGTGTGG - Intronic
900544514 1:3220992-3221014 CAAGAGAGGGAGACCCTGTCTGG + Intronic
900653686 1:3744438-3744460 CGACAGAGTGAGACTCCGTCAGG + Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901362642 1:8715881-8715903 TGACAGAGCAAGACCCTGTCTGG + Intronic
901385313 1:8904424-8904446 CAACAGAGCGAGACCCTGTGAGG - Intergenic
901502431 1:9661406-9661428 CAACAGAATGAGACCCTATAAGG - Intronic
901650635 1:10740936-10740958 CGACAGGGTGAGACCCTGTCTGG + Intronic
901805291 1:11735020-11735042 CGACAGGGTGAGACCTTGTCTGG - Intergenic
902464718 1:16608961-16608983 CAACATAGTAAGACCCCGTCTGG + Intronic
902507527 1:16947856-16947878 CAACAGAGCAAGACTCTGTCTGG - Intronic
902910226 1:19590587-19590609 CAACAGAGTGATACTCTGTCTGG + Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903119557 1:21206360-21206382 TGACAGAGCGAGACCCTATCTGG - Intergenic
903202545 1:21754139-21754161 CAACAGAGTGAGACTCCATCTGG + Intronic
903303839 1:22398475-22398497 TGACAGAGTGAGACCCTGTCTGG + Intergenic
903520395 1:23943070-23943092 TGACAGAGTGAGACTCTGTCTGG + Intergenic
903552713 1:24169233-24169255 CAACAGCGAGGGACCATGTCTGG - Intronic
903873639 1:26456350-26456372 CAACAGAGGGAGACCCTGTCTGG + Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
903979031 1:27171827-27171849 CGACAGAGCAAGACTCTGTCTGG + Intergenic
903986136 1:27230422-27230444 ACACAGAATGAGACCCTGTCTGG - Intergenic
904065122 1:27743743-27743765 CAACAGAGCAAGACCCTGTTTGG + Intronic
904137859 1:28327991-28328013 CAACAGAGGGAGATCCTGTCTGG - Intergenic
904369624 1:30040198-30040220 AAGCAGAGGGAGGCCCTGACAGG + Intergenic
904641441 1:31933701-31933723 CAACAGAGTAAGACTCTGTCTGG + Intronic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905080560 1:35315904-35315926 TGACAGAGTGAGTCCCTGTCTGG + Intronic
905218275 1:36425711-36425733 CAACAGAGCAAGACTCTATCTGG + Intronic
905376034 1:37520866-37520888 CAACAGAGAGAGATCCTGGGAGG + Intergenic
905844153 1:41212854-41212876 CAACAAAGTGAGACTCTGTCTGG + Intronic
906337051 1:44942445-44942467 TGACAGAGTAAGACCCTGTCTGG - Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906439753 1:45831008-45831030 CGACAGAGTGAGACCTTGTCTGG + Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907049409 1:51319708-51319730 TGACAGAGTGAGACTCTGTCTGG - Intronic
907526094 1:55054983-55055005 CAATAGAGCGAGACTCCGTCTGG + Intronic
907536242 1:55161350-55161372 CAACAGAGCGAGACTCTGTCTGG + Intronic
908326141 1:63025638-63025660 CAACAGAGTGAGACCCTTGTTGG - Intergenic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908648817 1:66309938-66309960 AAACAGTGGGAGAGCCTGGCAGG - Intronic
908777135 1:67650921-67650943 CGACAGAGTAAGACTCTGTCTGG + Intergenic
909000410 1:70210693-70210715 CAACAGAGCGAGACCCTGTAGGG + Intronic
909101722 1:71357383-71357405 CACCAGAGGGAGACCCAGTTAGG - Intergenic
909427670 1:75546005-75546027 TAACATAGGGAGACCCCATCTGG - Intronic
909573591 1:77146933-77146955 CAAGAGAGAAAGACCCTGTGAGG + Intronic
909620491 1:77661834-77661856 CAACAGAGCAAGACCTCGTCTGG - Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
909834861 1:80241016-80241038 CAATATAATGAGACCCTGTCTGG + Intergenic
910770161 1:90822885-90822907 CGACAGAGGGAGGCTCTGACTGG + Intergenic
911080437 1:93923808-93923830 TGACAGAGTGAGACCCTGTCTGG + Intergenic
912422762 1:109556953-109556975 CAACAGAGTGAGACTGTCTCGGG - Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
912845970 1:113074886-113074908 AAACAGAGCGAGACTCCGTCTGG + Intronic
912986752 1:114441120-114441142 TAATAAAGCGAGACCCTGTCTGG + Intronic
913672648 1:121112085-121112107 TGACAGAGCAAGACCCTGTCTGG + Intergenic
913997371 1:143662200-143662222 CAACAGAGCGAGACTCCGTCTGG - Intergenic
914024417 1:143899449-143899471 TGACAGAGCAAGACCCTGTCTGG + Intergenic
914413499 1:147455385-147455407 CAACAGAGCAAAACCCTGTCTGG + Intergenic
914662898 1:149807470-149807492 TGACAGAGCAAGACCCTGTCTGG + Intronic
914673602 1:149890614-149890636 TGACAGAGTGAGACTCTGTCTGG - Intronic
914760604 1:150595377-150595399 CGACAGAGTGAGACCTGGTCTGG + Intergenic
914817568 1:151074328-151074350 CGACAGAGCGAGACTCCGTCTGG - Intronic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914943486 1:152043208-152043230 CAACAGAGGGAAACCCTGTCTGG + Intronic
915139633 1:153759252-153759274 CAACAGAGCAAGACCCTGTCTGG + Intronic
915150256 1:153825066-153825088 CAACAGAGTGAGACCTTGTCAGG + Intronic
915186797 1:154112834-154112856 CAACAGAATGAGACCCTGTCTGG + Intronic
915295276 1:154916867-154916889 CAACATAGTGAGACCTTGTCTGG - Intergenic
915338477 1:155162507-155162529 CTACAGAGGAAGACTCTGTCTGG - Intergenic
915426290 1:155829968-155829990 CCACAGAGCGAGACTCTGTCTGG - Intronic
915492171 1:156256944-156256966 CGACAGAGCGAGACTCTGTCTGG - Intronic
915841042 1:159213210-159213232 CGACAGAGTGAGACCTTGTCTGG + Intergenic
916141440 1:161702690-161702712 TGACAGAGTGAGACTCTGTCTGG + Intergenic
916228434 1:162514267-162514289 CAACAGAGTGAGACCATCTCTGG + Intronic
916710811 1:167405665-167405687 GAACAGAGCGAGACCCTGTTTGG + Intronic
917289354 1:173456417-173456439 CAACGGAGTGAGAACCTGACTGG - Intergenic
917910293 1:179637693-179637715 CAACAGAGTAAGGCCCTGTCTGG + Intronic
917938044 1:179888433-179888455 CAACATACTGAGACCCTGTCTGG - Intronic
918025379 1:180739758-180739780 AAACATAGTGAGACCCTGTCTGG - Intronic
918670025 1:187203335-187203357 CAACAGAGCAAGACTGTGTCTGG - Intergenic
918788414 1:188794252-188794274 GTACAGAGCGAGACTCTGTCTGG + Intergenic
918833191 1:189425202-189425224 CTACAGAGAGAGAGCCTGTCTGG - Intergenic
918943431 1:191029517-191029539 TGACAGAGGGAGACTCTGTCAGG + Intergenic
919288527 1:195598426-195598448 CAACAGAGCAAGACTCTGTCAGG - Intergenic
919508492 1:198430399-198430421 CGACAGAGCAAGACTCTGTCCGG - Intergenic
919874454 1:201853251-201853273 TGACAGAGCAAGACCCTGTCTGG - Intronic
919975984 1:202613098-202613120 CGACAGAGCGAGACTCTGTCTGG - Intronic
920947002 1:210539055-210539077 TGACAGAGGAGGACCCTGTCTGG + Intronic
921068391 1:211639009-211639031 CAACATAGGGACACCCAGTGTGG - Intergenic
921442499 1:215204164-215204186 CTATTGAGGTAGACCCTGTCTGG + Intronic
921782323 1:219180014-219180036 CAACAGAGTGAGACTCTGTCTGG - Intronic
922107093 1:222521998-222522020 CTACACAGGAAGAACCTGTCAGG + Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922571137 1:226635238-226635260 CGACAGAGTAAGACCCTGTCTGG - Intronic
922643291 1:227258153-227258175 CAACAGGGTGAAACCCTGTCCGG + Intronic
922657073 1:227394611-227394633 TGACAGAGCGAGACTCTGTCTGG + Intergenic
922731663 1:227951743-227951765 CAACAGAGTGAGACTCTGTCTGG + Intergenic
922831312 1:228555945-228555967 TCACAGAGCGAGACTCTGTCTGG - Intergenic
923072443 1:230577926-230577948 CAACAGAACAAGACCTTGTCTGG - Intergenic
923157828 1:231293969-231293991 CAACAGAGTGAGACTCTGTCTGG + Intergenic
924090949 1:240500316-240500338 CAACAGAGCAAGACTCTGTCTGG - Intronic
924184343 1:241471998-241472020 TGACAGAGGGAGACTCCGTCTGG - Intergenic
924213202 1:241791650-241791672 CGAAAGAGTGAGACCCTGTCTGG + Intronic
924237887 1:242014431-242014453 CAACAGAGCAAGACCCTGTCTGG - Intergenic
924704337 1:246487438-246487460 CAACAGAGCAAGACTCTGTCTGG + Intronic
924918430 1:248599168-248599190 CGACAGAGCGAGACTCTGTCTGG + Intergenic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1062947625 10:1473400-1473422 CAACAGAGTGAGGCCCTGTCAGG - Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063108799 10:3017383-3017405 CAGCAGAGTGAGACTCTGTTTGG + Intergenic
1063132361 10:3189191-3189213 CAACAGAGAGAGGCCCTGTCAGG - Intergenic
1063158434 10:3401019-3401041 CAACAAAGTGAGACTCTGTCTGG + Intergenic
1063237015 10:4127459-4127481 CAACAGAGCAAGACTCTGTCTGG + Intergenic
1063644012 10:7860254-7860276 TGACAGAGCCAGACCCTGTCTGG + Intronic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064112958 10:12554175-12554197 CAACAGAGCGAGATTCTGTCAGG - Intronic
1064113010 10:12554557-12554579 CAACAGAGCAAGATCCTGCCTGG - Intronic
1064180642 10:13111674-13111696 CGACAGAGTGAGACTCTGTCTGG + Intronic
1064706048 10:18073730-18073752 CAACAGAGCGAGACCCTGTCTGG - Intergenic
1064997167 10:21306436-21306458 TGACAGAGTGAGACCCTGTCTGG - Intergenic
1065164496 10:22960900-22960922 CAACAGAGGGAGAGCTTGCTGGG - Intronic
1065542678 10:26785703-26785725 CGACAGAGTCAGACTCTGTCTGG + Intronic
1065620126 10:27572333-27572355 CGACAGAGCAAGACTCTGTCTGG - Intergenic
1065691328 10:28336741-28336763 TGACAGAGTGAGACTCTGTCTGG + Intergenic
1065715232 10:28560339-28560361 CAACAAAGCGAGATCCTGTCGGG + Intronic
1065777071 10:29130932-29130954 TGACAGAGCGAGACTCTGTCTGG - Intergenic
1065914742 10:30344722-30344744 CAATAGAGTGAGACTCTGTCTGG - Intronic
1065925283 10:30429626-30429648 CGACAGAGTGAGACTGTGTCTGG + Intergenic
1066246481 10:33588218-33588240 TGACAGAGCCAGACCCTGTCTGG + Intergenic
1066360254 10:34723272-34723294 CAACAGAGCGAGGCTCTGTCTGG + Intronic
1066423649 10:35285033-35285055 CAACAGAGCAAGACTCTGTCTGG - Intronic
1066589582 10:36979852-36979874 CAACATGGTGAAACCCTGTCGGG + Intergenic
1067260946 10:44690940-44690962 CAACAGAGCAAGACTCTGTCTGG - Intergenic
1067306769 10:45071628-45071650 CAACAGAGCAAGAGCCTGTTGGG - Intergenic
1067581611 10:47450015-47450037 CAACAGAAAGAGACCCCGACGGG - Intergenic
1068308504 10:55247870-55247892 TGACAGAGTGAGACGCTGTCTGG + Intronic
1068596482 10:58907602-58907624 TGACAGAGTGAGATCCTGTCTGG + Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069017417 10:63445892-63445914 AACCAGAGTGAGACTCTGTCTGG - Intronic
1069058619 10:63870655-63870677 AGACAGAGTGAGACCCTGTCTGG - Intergenic
1069099397 10:64299589-64299611 CAACAGCGTGAGACCCTGTCTGG + Intergenic
1070212886 10:74345320-74345342 CAACAAAGCAAGACCCTGTCTGG - Intronic
1070264407 10:74887964-74887986 TGACAGAGTGAGATCCTGTCTGG + Intronic
1070306576 10:75243165-75243187 CAACAGAGGGAGACTCCATCTGG - Intergenic
1070814162 10:79312743-79312765 CAACTGAGGGCCACCCGGTCGGG + Exonic
1071114312 10:82199150-82199172 TGACAGAGTGAGACTCTGTCCGG + Intronic
1071263626 10:83943702-83943724 AAAGAGATGAAGACCCTGTCAGG - Intergenic
1071386176 10:85123626-85123648 CAACAAAGGGAGACCATGTTGGG + Intergenic
1071548232 10:86545015-86545037 CAACACAGTGAGACCCTGTCTGG - Intergenic
1071831915 10:89380453-89380475 TGACAGAGGGAGGCCCTGTCTGG - Intronic
1071882963 10:89919175-89919197 CAACAGAGCAAGACTCTGTCTGG + Intergenic
1072095214 10:92171632-92171654 CAACAGAGTGAGACTCTCTCTGG - Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072606715 10:96990185-96990207 CGACAGAGTGAGACCCTGTCTGG - Intergenic
1073141375 10:101250551-101250573 CAACAGAGTGAGACTGTCTCAGG - Intergenic
1073337670 10:102722552-102722574 CGACAGAGTGAGACCCTGTCTGG - Intronic
1073408003 10:103315203-103315225 TGACAGAGTGACACCCTGTCTGG - Intronic
1074215340 10:111378749-111378771 CAACAGAGTGAGACTCCATCTGG - Intergenic
1074347051 10:112697211-112697233 TAACAGAGCAAGACCCTGTCTGG - Intronic
1074956823 10:118399138-118399160 CGACAGAGCGAGACTCTGTCTGG - Intergenic
1075169573 10:120101150-120101172 CAACATAGTGAGACCCTGTGTGG - Intergenic
1075320340 10:121486460-121486482 CAACAGAGCGAGACTCTGTCTGG - Intronic
1075387964 10:122070902-122070924 TAGCAGAGGAAGACCCTGTCTGG + Intronic
1075765557 10:124890329-124890351 GAACAGAAGGTGACCTTGTCTGG - Intergenic
1076403669 10:130198547-130198569 CGACAGAGCAAGACTCTGTCTGG + Intergenic
1076588452 10:131567259-131567281 CAGCAGAGGGACATCATGTCTGG - Intergenic
1077260564 11:1617151-1617173 GAGCACAGGGAGACCCTGTATGG - Intergenic
1077434869 11:2534139-2534161 CAGCAAAGTGAGACCCTGTAGGG + Intronic
1077592323 11:3501755-3501777 TGACAGAGTGAGACCCTGTATGG + Intergenic
1077616773 11:3681057-3681079 CAACACCGTGAGACCCTGTCTGG - Intronic
1078125451 11:8557229-8557251 CAACAGAGGGGGACCTTGTGGGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078245137 11:9567494-9567516 CAACAGAGCAACACCCTGTCTGG - Intergenic
1078297429 11:10088041-10088063 CAACAGAGTGAGACCTTGTCTGG - Intronic
1078676158 11:13416332-13416354 CAACACAGTGAGACCCTGTCTGG + Intronic
1078791422 11:14546455-14546477 CAACAGAGCGAGACTCTGTCTGG - Intronic
1079255770 11:18828398-18828420 CAACAGAGCGAGACTCTGTCAGG - Intergenic
1079431749 11:20396616-20396638 CAACAGAGCAAGACTTTGTCGGG + Intronic
1080096476 11:28414361-28414383 TAACAGAGGGAGGCACTGGCAGG - Intergenic
1080150343 11:29045225-29045247 TGACAGAGCAAGACCCTGTCTGG + Intergenic
1080623090 11:34003931-34003953 TGATAGAGTGAGACCCTGTCTGG + Intergenic
1081881983 11:46461221-46461243 TGACAGAGGAAGACCCTGACTGG + Intronic
1081917915 11:46745655-46745677 CAACAAAAAGAGACCCTGGCTGG + Intronic
1082859222 11:57838059-57838081 TGACAGAGTGAGACCCTGTCTGG - Intergenic
1083802432 11:65054216-65054238 CAACTGAGGGAGACCTGGTCTGG + Intronic
1083840171 11:65299709-65299731 CGACAGAGTGAGACTCTGTCGGG - Intronic
1083847141 11:65342424-65342446 TAACAGAGGGAGACCCTGTCTGG + Intronic
1084119477 11:67060399-67060421 GGACAGAGGGTGACCCTGCCTGG + Intronic
1084248160 11:67874475-67874497 TGACAGAGTGAGACCCTGTATGG + Intergenic
1084867195 11:72068599-72068621 TGACAGAGAGAGACCCTGTCTGG + Intronic
1085030547 11:73268602-73268624 TGACAGAGTGAGACCCTGTCTGG + Intronic
1085087647 11:73681787-73681809 CGACAGAGCAAGACTCTGTCTGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085547338 11:77332292-77332314 TGACAGAGTGAGACCCTGTGGGG + Intronic
1085650502 11:78263611-78263633 CGACAGAGTGAGACTCTGTCTGG + Intronic
1085767903 11:79299477-79299499 CAAAAGAGGATGACCCTGCCTGG - Intronic
1085898497 11:80668180-80668202 CAACATGGTGAAACCCTGTCAGG - Intergenic
1086057110 11:82659505-82659527 CAACAGAGTGAGACTCTGTCAGG + Intergenic
1087036275 11:93758981-93759003 TGACAGAGCCAGACCCTGTCAGG + Intronic
1087403432 11:97697604-97697626 TGACAGAGCGAGACTCTGTCAGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087638839 11:100733803-100733825 CAACAGAGCAAGATTCTGTCTGG + Intronic
1088297312 11:108314133-108314155 CAACAGAGCCAGATCCTGTCTGG - Intronic
1088546103 11:110960733-110960755 CAACAGAGAGAGACTCTGTCTGG - Intergenic
1088707049 11:112473163-112473185 CAACAGAGCGAGACTCTGTCTGG + Intergenic
1088883443 11:113989419-113989441 CAAGAGAGGGAGACCCCGGGTGG - Intronic
1089249395 11:117146669-117146691 CGACTGACTGAGACCCTGTCGGG + Intronic
1089328713 11:117675315-117675337 CAACAGAGCGAGATCCTGGCTGG - Intronic
1089727562 11:120495992-120496014 CAACAGAGTGAGACTCAGTCAGG - Intergenic
1090018209 11:123104402-123104424 CAACAGGGCGAGACTCCGTCTGG - Intronic
1090122772 11:124050247-124050269 CGACAGAGCGAGATTCTGTCTGG - Intergenic
1090811152 11:130244645-130244667 CGACAGAGAGAGACTCTGTCTGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1090984760 11:131756396-131756418 CAACATAGAAAGACCTTGTCTGG + Intronic
1091232224 11:133996076-133996098 TAACAGACTGAGACCCTGTCTGG + Intergenic
1091702102 12:2670286-2670308 CAACAGAAGGAGCCCCGGGCAGG + Intronic
1091852606 12:3712472-3712494 CAACAGAGAGAGACACAGTTGGG + Intronic
1092124946 12:6068487-6068509 CAACAGAGCGAGACTGTCTCAGG - Intronic
1092213653 12:6665274-6665296 CCACAGAGCGAGATTCTGTCTGG - Intergenic
1092418443 12:8309867-8309889 TGACAGAGTGAGACCCTGTATGG + Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092466715 12:8739925-8739947 TGACAGAGCGAGACCCTGTCTGG - Intronic
1092522323 12:9287633-9287655 TGACAGAGTGAGACTCTGTCTGG + Intergenic
1092544960 12:9444229-9444251 TGACAGAGTGAGACTCTGTCTGG - Intergenic
1092675937 12:10919922-10919944 CTACAGAGCAAGACTCTGTCAGG - Intronic
1092793094 12:12086296-12086318 TGACAGAGTGAGACTCTGTCTGG + Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092851780 12:12635347-12635369 TGACAGAGTGAGACCCTGTCTGG + Intronic
1093400098 12:18735423-18735445 TAACATAGTGAGACCCTGTTTGG - Intronic
1093432276 12:19097757-19097779 TGACAGAGCAAGACCCTGTCTGG - Intergenic
1093470949 12:19501615-19501637 CTACAAAGTGAGACCCTGTCTGG + Intronic
1093849533 12:24018776-24018798 CAACAGAGTAAGACTCTGTCTGG + Intergenic
1094048549 12:26194968-26194990 CAACACAGTGAGCCCCTGTTTGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094427895 12:30334740-30334762 CAACAGAGCGAGACTCCGTCTGG + Intergenic
1094534713 12:31310888-31310910 CGACAGAGTGAGACTCTCTCAGG - Intronic
1094564065 12:31583656-31583678 CAACAGAGCAAGACTGTGTCTGG + Intronic
1095473472 12:42561929-42561951 CAACAGAGCAAAACTCTGTCTGG - Intronic
1095964110 12:47855306-47855328 CATCAGAGCGAGAATCTGTCTGG + Intronic
1096160273 12:49370800-49370822 CGACAGAGTGAGATCCTTTCTGG - Intronic
1096162230 12:49388391-49388413 TGACAGAGAGAGACCCTGTCAGG - Intronic
1096347119 12:50859233-50859255 CAACAGAGCAAGACTCTGTCTGG - Intronic
1096390456 12:51224732-51224754 CAACAATGCAAGACCCTGTCTGG - Intergenic
1096394024 12:51252111-51252133 TGACAGAGCGAGACTCTGTCTGG - Intronic
1096623376 12:52878389-52878411 CAACAGAACGAGACCCTGTCTGG + Intergenic
1096828030 12:54294390-54294412 CAGCAGAGGGAGCCGCTGTGTGG + Intronic
1096940225 12:55336238-55336260 GAACAGAGTCAGACCCTGCCTGG - Intergenic
1097018215 12:56002166-56002188 CAAGATAGGGAGACCCTGGGAGG - Exonic
1097124781 12:56765515-56765537 CAACAGAGCAACACCCTGTTTGG - Intronic
1097677914 12:62622958-62622980 CAACAGAGCGAGACTCCGTCTGG - Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098688277 12:73453296-73453318 CAACAGAGCAAGACCCTATGAGG + Intergenic
1098849698 12:75580813-75580835 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1098970322 12:76847836-76847858 TGACAGAGCGAGACCTTGTCTGG + Intronic
1099355585 12:81630914-81630936 CAACAGAGCTAGACTCTGTCTGG - Intronic
1099433897 12:82620358-82620380 TAACAGAGGCAGACTCTGTTTGG + Intergenic
1100222797 12:92524114-92524136 CAACAGAGCAAGACCCTGCCTGG + Intergenic
1100625516 12:96327565-96327587 CAACAGAGCAAGACCCTGCCTGG - Intronic
1100975256 12:100115740-100115762 TGACAGAGTGAGATCCTGTCTGG + Intronic
1100983368 12:100181766-100181788 CAACAGGATGAGACTCTGTCTGG + Intergenic
1101179682 12:102201449-102201471 CGACAGAGCGAGACTCTGTCTGG + Intergenic
1101502489 12:105317008-105317030 CAACATAGGAAGACCCTGTGAGG + Intronic
1101916978 12:108903456-108903478 CGACAGAGCAAGACTCTGTCGGG - Intergenic
1101925567 12:108968811-108968833 CAACAGAGCGAGACTCTGTCTGG - Intronic
1102069806 12:110008863-110008885 CGACAGAGCGAGACTCAGTCTGG + Intronic
1102070599 12:110015969-110015991 CAACAGAGCGAGATACTGTATGG - Intronic
1102117475 12:110414204-110414226 CAACACAGGGAGATCCAATCTGG + Intergenic
1102267685 12:111501909-111501931 CAACGGAGTCAGACCCTGTTTGG - Intronic
1102298047 12:111752203-111752225 TAACAGAGCAACACCCTGTCTGG + Intronic
1102686014 12:114725273-114725295 CAACAAAGAGAGACCCTGTCTGG - Intergenic
1102905767 12:116674170-116674192 CAACAGAATGAGAACCTATCTGG - Intergenic
1103406587 12:120680151-120680173 CAACAGAGTAAGACTCTGTATGG + Intergenic
1103556476 12:121769681-121769703 TGACAGAGTGAGACCCTGCCTGG + Intronic
1103640355 12:122346520-122346542 TGACAGAGTGAGACTCTGTCTGG - Intronic
1104453403 12:128889792-128889814 CAACGGAATGAGACTCTGTCAGG - Intronic
1104829700 12:131741721-131741743 CAACAGAGGGGGAGGCTGTGAGG - Intronic
1104839405 12:131814703-131814725 CAACATATTGAGACCCTGTCTGG + Intergenic
1104869971 12:131988012-131988034 CAACAGAGCAAGACCCTGTCTGG - Intronic
1105435039 13:20369381-20369403 CAACAGAGCGAGACCCTGTCTGG - Intergenic
1105496180 13:20932929-20932951 CAACAGAGCAAGACTCTGTTGGG - Intergenic
1106139460 13:26999707-26999729 CAGCAGAGTGTGACCCAGTCGGG + Intergenic
1106275590 13:28202980-28203002 CAACAGAGTGAGACCCTGTCTGG - Intronic
1106601990 13:31196219-31196241 CGACAGAGTGAGATTCTGTCTGG - Intergenic
1106648733 13:31666068-31666090 CAACAGAGTGAGAATCCGTCTGG - Intergenic
1107184194 13:37497849-37497871 CAACAGAGTAAGACTATGTCCGG + Intergenic
1107917203 13:45164704-45164726 TGACAGAGTGAGACCCTGTCTGG + Intronic
1107935681 13:45343259-45343281 CAACAGAGCAAGACCCCATCTGG - Intergenic
1108953467 13:56119859-56119881 CAACAGAGCGAGACTCTGTCTGG + Intergenic
1109244629 13:59938587-59938609 CAACAGAGGCAGACCTTGTTTGG + Intronic
1109534472 13:63698449-63698471 CAACAGAGTGAAACCCTGTCAGG + Intergenic
1110431267 13:75426854-75426876 CAACATGGGGAGACCCTGTCTGG + Intronic
1110441760 13:75533987-75534009 CAACAGACTGAGATCCTGTCTGG - Intronic
1110566574 13:76963405-76963427 CAACAAAGTAAGACCCTGTCTGG + Intergenic
1110566771 13:76965213-76965235 CAACAGGGCAAAACCCTGTCTGG - Intergenic
1110773283 13:79376217-79376239 CAACTGAGCAAGACCCTGTCTGG - Intronic
1111216455 13:85149138-85149160 CAACAGAGCGAGACCCTGACTGG - Intergenic
1111703970 13:91724835-91724857 CGACAGAGTGAGATCCTGTCTGG + Intronic
1111768965 13:92572013-92572035 CAACAGAATGAGCCCCTGTCTGG + Intronic
1111957587 13:94775536-94775558 CAACAGAGTGAGGCCTTGTCAGG + Intergenic
1112451953 13:99520586-99520608 CGACAGAGCAAGACTCTGTCTGG - Intronic
1112763856 13:102719856-102719878 CAACAGAGTAAGACCCTGTCTGG + Intergenic
1113119913 13:106915081-106915103 TGACAGAGCGAGACCCTGTCTGG + Intergenic
1113189374 13:107726627-107726649 CAACAGAGTGAGACTCCATCTGG - Intronic
1113225144 13:108151616-108151638 CAGCAGAGTGAGACCCTGTCTGG + Intergenic
1113723707 13:112581463-112581485 CGACAGAGTGAGACCTTGTCTGG - Intronic
1114175830 14:20318780-20318802 CGACAGAGTGAGACCCTATCTGG - Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1114446021 14:22788682-22788704 CGACAGAGTGAGACTCTGTCTGG + Intronic
1114470600 14:22958342-22958364 CAACAGAGCAAGACTCCGTCTGG - Intronic
1115233060 14:31182208-31182230 CGACAGAGCAAGACCCTGTCTGG - Intronic
1115273794 14:31584163-31584185 CAACAAAGCAAGACCCTGTCAGG - Intronic
1115632569 14:35260029-35260051 CAACAGAGTGAAACCCTATCTGG - Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116001598 14:39248757-39248779 CGATAAAGTGAGACCCTGTCTGG - Intronic
1116919532 14:50558337-50558359 CAACAGAGGGAGACTGTGTCTGG + Intronic
1116983106 14:51191789-51191811 CAACAGAGTGAGACTGTCTCAGG + Intergenic
1117132113 14:52696500-52696522 TGACCCAGGGAGACCCTGTCTGG - Intergenic
1117304133 14:54457094-54457116 CAACAGAGCAAAACCCTGTCTGG + Intergenic
1117361245 14:54976380-54976402 CAACATAGAGAGACCCTGCCAGG - Intronic
1117469054 14:56023916-56023938 CCACAGAGGGAAACCCTCTGAGG + Intergenic
1117521275 14:56553547-56553569 TAACAGAGACAGACCCTTTCTGG - Intronic
1118110037 14:62708282-62708304 CAACACAGGGTGACCCTGAGAGG - Exonic
1118181533 14:63498575-63498597 TGACAGAGTGAGACCCTGTCTGG - Intronic
1118206159 14:63725352-63725374 CAACAGAGCGAGACTCCGTCAGG + Intronic
1118263107 14:64266899-64266921 TGACAGAGTGAGACTCTGTCTGG - Intronic
1118417145 14:65552973-65552995 TGACAGAGCAAGACCCTGTCTGG - Intronic
1118834306 14:69465459-69465481 CAACAGAACAAGACTCTGTCTGG + Intergenic
1119054716 14:71407524-71407546 CAACAAAGTGAGACCCTGGGAGG - Intronic
1119458668 14:74779659-74779681 CAACAGAGTGAGACCCTGTCTGG - Intronic
1119548407 14:75490441-75490463 CAACATAGTGAGACTCTGTCTGG - Intergenic
1119815626 14:77564210-77564232 CAACAGAGGGAGACTCTGTCTGG + Intronic
1119951723 14:78752219-78752241 CAACAGGGTGAAACCCTGTTTGG + Intronic
1120679973 14:87469547-87469569 GTACAGAGTGAGACCCTGTGGGG - Intergenic
1120907298 14:89631545-89631567 CGACAGAGCGAGACTCCGTCTGG + Exonic
1121036729 14:90711439-90711461 CAACAGAGCGAGACTCCATCGGG - Intronic
1121248015 14:92477486-92477508 CAACAGAGTGAGGTCTTGTCTGG - Intronic
1122058436 14:99120882-99120904 CAACATAGAGAAACCCTGTCAGG + Intergenic
1122085564 14:99299562-99299584 AAAAAGAGTGAGACCCTGTCTGG + Intergenic
1122233076 14:100316918-100316940 CAACAGAGCGAGACTCTGTCTGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122581613 14:102775401-102775423 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1122672298 14:103382132-103382154 CAAGAGAGCAAGACCCTGTCTGG + Intergenic
1122686770 14:103512253-103512275 CGACAGAGTGACACTCTGTCTGG - Intergenic
1122997043 14:105270769-105270791 TGACAGAGCAAGACCCTGTCTGG + Intronic
1123005585 14:105321380-105321402 TGACAGAGTGAGATCCTGTCTGG - Intronic
1123911112 15:24967786-24967808 CAACAGAATGAGACCCTGTCTGG + Intronic
1123966933 15:25468541-25468563 CGACAGAGTGAGACTCTGTCTGG + Intergenic
1124033214 15:26030003-26030025 CAACAGAGTGAGACACTCTTGGG + Intergenic
1124379997 15:29157075-29157097 CGACAAAGCGAGACTCTGTCTGG + Intronic
1124908087 15:33891081-33891103 CAACAGAGTGAGACTCTGTCTGG + Intronic
1125662808 15:41407630-41407652 CAACAAAGTGAGACTCTGTCTGG - Intergenic
1125785178 15:42309997-42310019 TGACAGAGTGAGACCCTATCTGG + Intronic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126019590 15:44387161-44387183 CAGCAGAGCAAGACCTTGTCTGG + Intronic
1126030422 15:44491859-44491881 CAAAAGAGCCAGACCCTGTCTGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126355367 15:47789615-47789637 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1126605561 15:50472575-50472597 AGACAGAGCGAGACTCTGTCTGG + Intronic
1127107742 15:55635042-55635064 CAACAGAGGGCTCCCCAGTCAGG - Intronic
1127145881 15:56023245-56023267 CAACAGAGAGAGACTCCGTGTGG - Intergenic
1127358696 15:58226318-58226340 CAAGAGAGGCAGACACTGTGTGG - Intronic
1127429263 15:58886284-58886306 CTACAGAGCCAGACCCTGTCTGG - Intronic
1127570156 15:60233863-60233885 CAACAGAGGGAGACTGTCTCAGG + Intergenic
1127578965 15:60319644-60319666 CGACAGAGCAAGGCCCTGTCTGG + Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127615664 15:60683028-60683050 CAACACACTGAGAACCTGTCTGG - Intronic
1127785483 15:62351367-62351389 CCACAGAGTGAGACTCCGTCTGG + Intergenic
1128180649 15:65600600-65600622 TAACAAAGTGAGACCCTGTTTGG + Intronic
1128305696 15:66597671-66597693 TGACAGAGCGAGACTCTGTCTGG - Intronic
1128364600 15:66988801-66988823 CAACACAGAGAGACTCTGTTTGG + Intergenic
1128388658 15:67167971-67167993 CAACAGAGGGAGACTCTGTCTGG - Intronic
1128581156 15:68811040-68811062 CCACAGAGTGAGACTCTGTCTGG + Intronic
1129074354 15:72978933-72978955 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1129145001 15:73639115-73639137 CAACAGAGCGAGACTCTGTCTGG - Intergenic
1129218834 15:74119228-74119250 GGACAGAGTAAGACCCTGTCTGG - Intronic
1129404909 15:75309960-75309982 GAGCAGAGTGACACCCTGTCTGG + Intergenic
1129620566 15:77140752-77140774 TGACAAAGGAAGACCCTGTCTGG - Intronic
1130030841 15:80312103-80312125 TGACAGAGCGAGACTCTGTCTGG - Intergenic
1130078193 15:80708333-80708355 CGACAGAGCAAGACTCTGTCTGG - Intronic
1130111815 15:80971644-80971666 GGACAGAGTGAGACCCTGGCTGG - Intronic
1130165120 15:81448100-81448122 CAACAGAGCGAGACTCTGTCTGG - Intergenic
1130510606 15:84586157-84586179 GGACAGAATGAGACCCTGTCTGG - Intergenic
1131187405 15:90286466-90286488 CAACAGAGTAAGACCATGTTTGG + Intronic
1131281264 15:91023305-91023327 CAAAAGGGCGAGACTCTGTCAGG - Intergenic
1131486825 15:92827934-92827956 CGACAGATAGAGACTCTGTCGGG - Intergenic
1131809022 15:96153101-96153123 AGTCAGAGTGAGACCCTGTCTGG + Intergenic
1131817419 15:96235664-96235686 AGACAGAGTGAGACCTTGTCTGG + Intergenic
1131912177 15:97219437-97219459 CAACAGAGTGAGACTCTATAGGG - Intergenic
1131949764 15:97669352-97669374 CAACAGAGCAAGACCCTGACTGG - Intergenic
1132104064 15:99050251-99050273 CAACAGAGCCAGACCCTGTTTGG + Intergenic
1132181603 15:99757615-99757637 CAACAGAGTGAACCCCTGTCTGG - Intergenic
1132276767 15:100573136-100573158 CAACAGATGGAGATCCTTTCAGG - Intronic
1132521533 16:392288-392310 CAACAGGGCGAGACCCGGTCTGG - Intergenic
1132837267 16:1960237-1960259 CAACAGAGTGAGACTGTCTCAGG - Intronic
1133105885 16:3509227-3509249 CAACAGAACGAGACCTTGTCTGG + Intronic
1133124447 16:3636798-3636820 CAACAGAGTGAGACTCTGTCTGG + Intronic
1133329240 16:4961346-4961368 CAACAGAGTGAGACTCAGTCTGG - Intronic
1133369468 16:5237125-5237147 CAAGAGAGTGAGACCCTGTCTGG + Intergenic
1133461006 16:5986079-5986101 AACAAGAGCGAGACCCTGTCTGG - Intergenic
1133561559 16:6955219-6955241 CAACAGAGTGAGACCTTGTCTGG + Intronic
1133819834 16:9226346-9226368 CAACAGAGCCAGACCCTGTCAGG - Intergenic
1133946638 16:10354590-10354612 TAACAAAGTGAGCCCCTGTCAGG + Intronic
1133979287 16:10621631-10621653 TGACACAGTGAGACCCTGTCTGG + Intergenic
1133987892 16:10682345-10682367 TGACAGAGTGAGACTCTGTCTGG - Intronic
1134068691 16:11247105-11247127 TGACAGAGTGAGACTCTGTCGGG - Intergenic
1134118524 16:11567398-11567420 CAACAGAGCAAGACTCCGTCTGG + Intronic
1134130416 16:11645867-11645889 TGACAGAGTGAGACTCTGTCTGG - Intergenic
1134241625 16:12510974-12510996 CGACAGAGTGAGACTCTGTGGGG - Intronic
1134375975 16:13673619-13673641 CATCAGAGTGAGACCCTGTCAGG + Intergenic
1134448929 16:14351597-14351619 CGACAGAGTGAGACTCTGTCTGG + Intergenic
1134464703 16:14464734-14464756 CAACAGAGGAAGATTCTGTTTGG + Intronic
1134525881 16:14943174-14943196 CAACAGAGGGAGACTCCTTTTGG - Intronic
1134568320 16:15270066-15270088 TGACAGAGTGAGACCCTGGCAGG + Intergenic
1134734111 16:16486294-16486316 TGACAGAGTGAGACCCTGGCAGG - Intergenic
1134744501 16:16577335-16577357 TGACAGAGTGAGACCCTGTCTGG - Intergenic
1134933388 16:18225987-18226009 TGACAGAGTGAGACCCTGGCAGG + Intergenic
1135000986 16:18776417-18776439 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1135019825 16:18954211-18954233 CAACAGAGCCAGACTCTCTCGGG - Intergenic
1135035496 16:19073471-19073493 TGACAGAGTGAGACCCTGTCTGG + Intronic
1135079627 16:19422926-19422948 CCACAGAGCGAGACTCAGTCTGG + Intronic
1135108015 16:19667712-19667734 CGACAGAGCAAGACCCTGTCTGG + Intronic
1135199932 16:20428532-20428554 CAAAAGAGGGAGAACAGGTCAGG - Intronic
1135697307 16:24601216-24601238 CAACAGAGCTAGACTCTGTCTGG - Intergenic
1135706185 16:24677180-24677202 CAACAGAGCGAGACTCTGTCAGG - Intergenic
1135760791 16:25136567-25136589 CAACAGAGTGAGACTCTGACGGG - Intronic
1136039115 16:27564042-27564064 CAACAGAGCAAGACCCTGTCTGG + Intronic
1136465731 16:30442357-30442379 CAACAGAGTGAGACTTTGTCCGG + Intergenic
1136484909 16:30565449-30565471 CAACATAGTGAGACCCTGTCTGG + Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1136579028 16:31140942-31140964 CGACAGAGCAAGACTCTGTCTGG - Intronic
1136657155 16:31716397-31716419 ACACAGTGAGAGACCCTGTCAGG - Intronic
1137424860 16:48369700-48369722 CAACAGAGTGAGACCCTGTCTGG + Intronic
1137794403 16:51203129-51203151 CTATAGAGTGAGACCCTGTCAGG - Intergenic
1137797659 16:51235885-51235907 CGACAGAGGGAGACCCTGTCCGG - Intergenic
1138185749 16:54976162-54976184 CAACAGAGCGACACCGTTTCTGG - Intergenic
1138472234 16:57246782-57246804 CGACAGAGCGAGACTCCGTCTGG + Intronic
1138494785 16:57401502-57401524 AAACAGAGCAAGACTCTGTCTGG + Intergenic
1138687548 16:58738942-58738964 CAACAGAGTGAGACGCTGTCAGG + Intergenic
1138693102 16:58787146-58787168 CAATAGAGCGAGACTCTGTCGGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139709794 16:68767212-68767234 CAACAGAGCGAGACTGTCTCAGG - Intronic
1139849947 16:69945103-69945125 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139878934 16:70168011-70168033 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1139902676 16:70340698-70340720 CGACAGAGCGAGACTCCGTCTGG - Intronic
1140051377 16:71484420-71484442 CACCAGAGGGAGACCGGGACCGG + Intronic
1140366176 16:74382940-74382962 CAACAGAGGGAGACTCGTTTCGG - Intronic
1140373584 16:74427482-74427504 TGACAGAGTGAGACCCTGTCTGG - Intergenic
1140460466 16:75135586-75135608 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1140503053 16:75451528-75451550 TGACATAGGGAGACCCTGTCTGG + Intronic
1140571629 16:76113214-76113236 CTACAGAGCAAGACTCTGTCTGG + Intergenic
1140692577 16:77498711-77498733 TAACAGAGCGAGACCCTGTCTGG + Intergenic
1141251592 16:82363815-82363837 TAACAGTGGGAGAGTCTGTCTGG + Intergenic
1141301987 16:82825559-82825581 CAACAGAGGGAGACTCTGTTTGG - Intronic
1141485345 16:84335082-84335104 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1142570539 17:870733-870755 CAACAGAGTGAGACTCTGTCTGG + Intronic
1142606046 17:1081595-1081617 TGACAGAGCGAGACCCTGTCTGG - Intronic
1142643380 17:1297621-1297643 CGACAGAGCAAGACTCTGTCTGG - Intronic
1142750468 17:1984381-1984403 TGACAGAGCGAGACCCTGTCTGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143092740 17:4458702-4458724 CAACACAGGGAGACCCTGTCTGG - Intronic
1143133390 17:4695300-4695322 CAACAGAGTGAGACTCCGTCTGG + Intronic
1143361679 17:6376271-6376293 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1144292314 17:13838225-13838247 CGACAGAGCGAGACGCCGTCCGG + Intergenic
1144943530 17:18958088-18958110 CAACAGAGTGAAATCCTGTCTGG - Intronic
1145930596 17:28682599-28682621 CAACAGAGCGAGACCGTCTCAGG + Intronic
1146068082 17:29653604-29653626 CAACAGAGTGAGACTCTGTCTGG - Intronic
1146162516 17:30567568-30567590 CAAATGAGAGAGACGCTGTCTGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146245837 17:31282038-31282060 CAATGGAGAGAGACCCTGTCTGG + Intronic
1146392511 17:32435760-32435782 CAACAGAGCGAGACTCTGTCTGG + Intergenic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146801994 17:35832056-35832078 CAACAGAGCAAGACTCCGTCTGG + Intronic
1146862680 17:36318154-36318176 CAACAGAATGAGACCCTGTCTGG + Intronic
1146973453 17:37091597-37091619 CAACAGGAGGAGACCCTGTCTGG - Intronic
1147005658 17:37401577-37401599 CAACAGAGTGAGACCTCGTCTGG - Intronic
1147021045 17:37533379-37533401 TGACAGAGTGAGACTCTGTCTGG + Intronic
1147093008 17:38122250-38122272 CAACAGAATGAGACCCTGTCTGG + Intergenic
1147104200 17:38198238-38198260 CAACAGAATGAGACCCTGTCTGG - Intergenic
1147201361 17:38804023-38804045 CAACAGAGTGAGACCTTGTAGGG + Intronic
1147203046 17:38816702-38816724 CAACAGAGTGAAACTCTGTCTGG - Intronic
1147280109 17:39352659-39352681 CAACAGAGTGAAGCTCTGTCTGG + Intronic
1147288931 17:39425780-39425802 CGACAGAGTGAGACTCTGTCTGG + Intronic
1147340001 17:39747605-39747627 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1147572293 17:41578957-41578979 GCACAGAGGGAAGCCCTGTCAGG + Intergenic
1147579511 17:41620349-41620371 CAAATGAGAGAGACACTGTCTGG - Intronic
1147621033 17:41866834-41866856 CGACAGAGTGATACCCTGTCTGG + Intergenic
1147658819 17:42106137-42106159 TAACAGAGTGAGACTCTGTCTGG + Intronic
1147673125 17:42188408-42188430 CAACACAGCGAGACCATCTCGGG - Intergenic
1147742652 17:42677603-42677625 CAAGACAGCGAGACCCTGTCTGG - Intergenic
1147781831 17:42948658-42948680 CAACAGAGTGAGACTATATCTGG + Intergenic
1148005853 17:44428778-44428800 TGACAGAGTGAGATCCTGTCTGG + Intronic
1148425293 17:47590175-47590197 CAACAGAATGAGACCCTGTCTGG + Intronic
1148810539 17:50287865-50287887 CAACAGAGCAAGGACCTGTCTGG + Intergenic
1148982590 17:51591589-51591611 CAACAAAGTGAGACCAAGTCTGG + Intergenic
1149748691 17:59124410-59124432 CAACAGAGTGAGACTCTGTCTGG + Intronic
1149878436 17:60262966-60262988 CAACAGAATGAGAACTTGTCTGG - Intronic
1149968836 17:61195377-61195399 CAACAGAATGAGACCTTGTCTGG - Intronic
1150032445 17:61753801-61753823 CAACACAGCAAGACCCTCTCTGG - Intronic
1150697448 17:67418018-67418040 TGACAGAGCAAGACCCTGTCTGG + Intronic
1150767286 17:68012218-68012240 CAACAGAGCAAGACCGTGTCTGG + Intergenic
1150772853 17:68056252-68056274 TGACAGAGTGAGACCTTGTCTGG - Intergenic
1150797787 17:68252707-68252729 CAACACAGGGAGATCCCATCTGG - Intronic
1150972038 17:70039802-70039824 CAACAGAGCAAGAATCTGTCTGG - Intergenic
1151011592 17:70504152-70504174 CAACAGAGCAAGACTCTATCTGG + Intergenic
1151044946 17:70908919-70908941 CAATAGAGTGAGACCCTGGGAGG - Intergenic
1151576584 17:74955479-74955501 CGACAGAGTGAGACGCCGTCGGG + Intronic
1151593371 17:75061628-75061650 TGACAGAGCTAGACCCTGTCTGG + Intronic
1151605594 17:75133382-75133404 TGACAGAGGGAGTCCCTGTTGGG + Intergenic
1151735892 17:75940260-75940282 CAACAGAGCGAGACCCTGTCTGG - Intronic
1151861834 17:76770049-76770071 CGACAGAGCGAGACTCTGTCTGG - Intronic
1151862296 17:76773627-76773649 CAACTGAGCGAGACTCCGTCTGG - Intronic
1151882423 17:76903529-76903551 CACCTGAGGGAGACTCTTTCTGG - Intronic
1151959821 17:77399811-77399833 GGACAGAGGGACACCATGTCGGG + Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152104020 17:78318534-78318556 CATCAGAGGGTGACCCTGGGAGG + Intergenic
1152106795 17:78334897-78334919 CAGCAGAGTGAGACGCTGTCTGG - Intergenic
1152127301 17:78454927-78454949 TGACAGAGTGAGACTCTGTCAGG - Intronic
1152177096 17:78794986-78795008 CGACAGAGGGAGACTCTGTTCGG + Intronic
1152398232 17:80048238-80048260 CAACAGAGCAAGACTCTGTCTGG + Intronic
1152439339 17:80296037-80296059 CCACAGAGTGAGACGCCGTCTGG - Intronic
1152512080 17:80797150-80797172 CAGCAGAGCGAATCCCTGTCTGG - Intronic
1153009305 18:523373-523395 CCACAGAGTGAGACTCTGTCTGG + Intergenic
1153187097 18:2498185-2498207 CTCCAGAGTGAGACTCTGTCTGG - Intergenic
1153199757 18:2636005-2636027 CAACAGAGGGACTCCGTCTCGGG - Intergenic
1154214282 18:12404321-12404343 CAACAGAACAAGACCTTGTCTGG + Intergenic
1154346343 18:13546386-13546408 CAACAGGGCAAGACTCTGTCAGG - Intronic
1154946841 18:21170229-21170251 CAACAGTGCGAGACTCTGTCTGG + Intergenic
1154960613 18:21304997-21305019 CAACAGAGCGACACTCTGTCTGG - Intronic
1154992087 18:21607050-21607072 CAACAGAGCGAGACTCCATCTGG - Intergenic
1155035808 18:22023943-22023965 CAACAGAGCGACACCCTGCCAGG + Intergenic
1155266899 18:24103080-24103102 CAACAGAGTGAGACCGTGTCTGG + Intronic
1155501613 18:26492220-26492242 CAATAGAGTGAGACCCTATCTGG + Intronic
1155860495 18:30891559-30891581 AGACAGAGCGAGACTCTGTCTGG + Intergenic
1155955310 18:31951902-31951924 CGACAGAGTGAGACCCCGTCTGG + Intronic
1156082446 18:33354628-33354650 CGACAGAGTGAGACTCTGTCTGG - Intronic
1156267950 18:35505187-35505209 CAAGGGAGGGAGACCCATTCTGG + Intergenic
1156568567 18:38224474-38224496 TAGCAGAGCAAGACCCTGTCTGG - Intergenic
1156968339 18:43124043-43124065 TAACAGAATGAGACCCTGTCTGG - Intergenic
1157459928 18:47881895-47881917 TGACAGAGCAAGACCCTGTCGGG - Intronic
1157462424 18:47911329-47911351 CAACAGAGCGAGACTCCATCTGG + Intronic
1157549074 18:48568437-48568459 CTACAGAAGGAGTGCCTGTCAGG - Intronic
1157997713 18:52578958-52578980 CAACAGAGTGAGACTCCGTCTGG + Intronic
1158490223 18:57903244-57903266 TGACAGAGCGAGACCCTCTCTGG - Intergenic
1158575702 18:58635769-58635791 CAACAAAGTGAGACTTTGTCTGG + Intergenic
1159052305 18:63432494-63432516 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1159259619 18:65996163-65996185 AAACAGAGCAAGACCCTATCTGG - Intergenic
1159672523 18:71239346-71239368 CACCAGAGGGAGAGCCAGGCAGG + Intergenic
1159916779 18:74195019-74195041 CGACAGAGCAAGACCCTGTTGGG - Intergenic
1160779221 19:870539-870561 CAACAGAGTGAGACCCTGTCGGG + Intronic
1161124570 19:2548459-2548481 CGACAGAGCGAGGCTCTGTCTGG + Intronic
1161188931 19:2942392-2942414 CAACAGAGCTAGACCCTGTCTGG - Intronic
1161307469 19:3576034-3576056 CCACGGAGGGAGGCCCTGCCTGG - Intronic
1161424245 19:4193815-4193837 CGACAGAGCGAGACTCCGTCGGG + Intronic
1161616754 19:5275088-5275110 CGACAGAGTGAGACACTGTCTGG - Intronic
1161682937 19:5689209-5689231 CGACAGAGCAAGACCCTGTCTGG + Intronic
1161716439 19:5878708-5878730 CGACAGAGGGAGACTCCGTCTGG - Intronic
1161758646 19:6153826-6153848 CAACAGAGTGAGACCCTGTCTGG + Intronic
1162214612 19:9123013-9123035 CAACAGAGTGAGACTTTGTCTGG - Intergenic
1162280825 19:9696567-9696589 CAACAGAGTGAGACCCTGTCTGG - Intronic
1162451714 19:10758959-10758981 CAATAGAGCGAGACTCTGTGTGG - Intronic
1162455996 19:10785135-10785157 CAACAGAGCGAGACTCCATCTGG - Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162759848 19:12882172-12882194 CAACAGAGCGAGATATTGTCCGG - Intergenic
1162761706 19:12892309-12892331 CAACAGAGCCAGACTCTGTTGGG - Intronic
1163119049 19:15205234-15205256 TAACAGAGCAAGACCCTGTGGGG + Intergenic
1163133534 19:15292342-15292364 CAGCAGAGGCAGACCCTTTGGGG - Intronic
1163261340 19:16192073-16192095 CAAGAGAGTGAAACTCTGTCTGG - Intergenic
1163589576 19:18184719-18184741 CAACAGAGCAAGACTCTTTCAGG - Intergenic
1163719263 19:18890759-18890781 CAACAGAGTAAGACCGCGTCTGG + Intronic
1163719417 19:18891595-18891617 CAACAGAGCGAGACCCTGCCTGG - Intronic
1163778247 19:19230746-19230768 CAACTGACCAAGACCCTGTCTGG - Intronic
1163805214 19:19392410-19392432 TGACAGAGCGAGACTCTGTCTGG - Intronic
1163879411 19:19904037-19904059 CAACAGAGCGAGATTCTGGCTGG + Intronic
1164196820 19:22974877-22974899 CAACAGAGGGAGACTGTCTAGGG - Intergenic
1164921645 19:32092915-32092937 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1164979910 19:32606170-32606192 CGACAGAGCGAGACTCTGTCTGG - Intronic
1165131031 19:33632157-33632179 TGACAGAGGGAGACCCTGTCTGG - Intronic
1165323274 19:35099369-35099391 CAACAGAGCAAGACCCTGTCTGG + Intergenic
1165383682 19:35497973-35497995 CAACAGAGGGAGACCCTGTCTGG - Intronic
1165771463 19:38382890-38382912 TGACAGAGCGAGACTCTGTCTGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166177454 19:41084891-41084913 AAACAGTGGCACACCCTGTCAGG + Intergenic
1166189799 19:41168766-41168788 CAACAGAGCAAGACCCTTTCTGG - Intergenic
1166528696 19:43529400-43529422 CAACATAGCAAAACCCTGTCTGG + Intronic
1166547330 19:43640986-43641008 CAACAGAGCGAGACTCCGTCTGG - Intergenic
1166664066 19:44666648-44666670 CGACAGAGTGAGAATCTGTCAGG + Intronic
1166698647 19:44868890-44868912 CGACAGAGTGAGACTCTGTCTGG + Intronic
1166900190 19:46055275-46055297 CAACACAGTGAGACCCTATCTGG - Intronic
1166941604 19:46369904-46369926 CAGCAGAGCGAGACTCCGTCTGG + Intronic
1166946328 19:46399152-46399174 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1167067293 19:47196063-47196085 CAACAGAGCGAGACTCCGTCTGG - Intronic
1167070547 19:47219670-47219692 TGACAGAGCAAGACCCTGTCTGG - Intergenic
1167123623 19:47533965-47533987 CAGGAGAGGCAGCCCCTGTCTGG - Intronic
1167281011 19:48568580-48568602 CAAGTGAGGGAGAGCCTGGCGGG + Intronic
1167342969 19:48926919-48926941 CTACAAAGCAAGACCCTGTCTGG + Intergenic
1167450635 19:49566484-49566506 CAACATAGCAAGACCCTGCCTGG - Intronic
1167554043 19:50181819-50181841 CAACAGAGAAAGACCCTGGAGGG - Intergenic
1167765005 19:51476253-51476275 GGACAGAGTGAGACTCTGTCTGG + Intergenic
1167795089 19:51703776-51703798 CGCCAGAACGAGACCCTGTCTGG + Intergenic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1167996007 19:53402747-53402769 CAACACAGCAAGACCCTGTCTGG - Intronic
1168001493 19:53449875-53449897 CAACACAGCAAGACCCTGTCTGG - Intronic
1168218471 19:54943579-54943601 CGACAGAGCGAGACTCCGTCTGG + Intronic
1168596305 19:57680546-57680568 CAACAGAGTGAGACTCCGTCTGG + Intergenic
1168672035 19:58247932-58247954 TGACAGAGTGAGACTCTGTCTGG - Intronic
1168708538 19:58483628-58483650 CAACAGGATGAGACCCTGTCTGG + Intronic
925371031 2:3345603-3345625 CAATAGAGCGAGACTCTGTCTGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925429853 2:3781843-3781865 TGACAGAGAGAGACTCTGTCTGG + Intronic
925532921 2:4884155-4884177 CCACTGTGGGAGACCCTCTCTGG + Intergenic
926249331 2:11145001-11145023 CGACAGTGCGAGACTCTGTCTGG - Exonic
926379780 2:12275379-12275401 CAACAAAGCGAGACTCCGTCTGG + Intergenic
927557484 2:24046092-24046114 TGACAGAGTGAGACCCTGTTGGG + Intronic
927632439 2:24786227-24786249 CAACAGAGTGAGACTTTGTCTGG - Intergenic
927767150 2:25821335-25821357 TGACAGAGCAAGACCCTGTCAGG + Intronic
927782508 2:25951143-25951165 CAACAGAGTGAGGCCTTGCCCGG - Intronic
927803684 2:26125464-26125486 GAACAGAGCAAGAACCTGTCTGG - Intronic
927961880 2:27245618-27245640 TACCTGAGGGAGACCTTGTCAGG - Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928016203 2:27660248-27660270 TGACTGAGTGAGACCCTGTCTGG - Intronic
928141239 2:28731222-28731244 CGACAGAGTAAGACCCTGCCAGG - Intergenic
928150561 2:28824454-28824476 CAACAGAGCAAGATGCTGTCAGG + Intronic
928159591 2:28909851-28909873 CAACACAGTGAGACCCTGTTTGG + Intronic
928344628 2:30480229-30480251 CAAAAGAGCAAGCCCCTGTCTGG - Intronic
928497571 2:31849578-31849600 CAACACAGGGAGACCGTCTTGGG + Intergenic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928667696 2:33567186-33567208 CAACAGAGCGACACACTGTCTGG + Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930059986 2:47280288-47280310 TGACAGAGCGAGACCCTGTCTGG - Intergenic
930110462 2:47674691-47674713 TGACAGAGTGAGACCCTGTCTGG + Intergenic
930525972 2:52530108-52530130 CAACAGAATGAGACCCTGTCTGG - Intergenic
930695631 2:54408871-54408893 AGACAGAGTGAGATCCTGTCTGG - Intergenic
931349372 2:61473736-61473758 TGACAGAGTGAGACCCTCTCTGG + Intergenic
931513436 2:63024974-63024996 CAACAGAGCGAGATCCACTCTGG + Intronic
931670795 2:64644926-64644948 CAACAGGGAGAGACCGTCTCTGG + Intronic
931740048 2:65233920-65233942 CAACAGAGTGAGACCCTGTCAGG - Intronic
932382639 2:71299198-71299220 CAACAGAGCGAGACCCTGTCTGG + Intronic
932559278 2:72852909-72852931 TGACAGAGTGAGACCCTGTCTGG + Intergenic
932724729 2:74169646-74169668 CAACAGAGTGAGACCCAGTCGGG - Intronic
933592488 2:84248305-84248327 CAACAGAGTGAGACTCTGTCAGG - Intergenic
933672924 2:85026508-85026530 GAACAGAACAAGACCCTGTCTGG - Intronic
933945548 2:87283366-87283388 TGACAGAGTGAGACTCTGTCTGG - Intergenic
934706048 2:96481936-96481958 CAACAGAGCGAGACTCTGTCTGG + Intergenic
934857574 2:97738751-97738773 CAACAGATAGACACCCTCTCTGG + Intronic
935243522 2:101198483-101198505 CGACAGAGCGAGAACTTGTCTGG - Intronic
935265998 2:101394808-101394830 CCACAGAGCGAGGCCCTGTCCGG - Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
936011067 2:108925635-108925657 CAACAGAAGGAGACTGTTTCAGG - Intronic
936334664 2:111578220-111578242 TGACAGAGTGAGACTCTGTCTGG + Intergenic
936696919 2:114961766-114961788 CAACATGGTGAAACCCTGTCTGG + Intronic
936939482 2:117869785-117869807 CGAAAGAGTGAGACTCTGTCTGG - Intergenic
937202692 2:120215613-120215635 CGACAGAGCGAGACTCCGTCTGG - Intergenic
937374510 2:121326518-121326540 TGACAAAGTGAGACCCTGTCTGG - Intergenic
937802082 2:126092000-126092022 CAACATAGGGAGACCTGGTCTGG - Intergenic
938275621 2:130018971-130018993 CAACAGAGTGAAACTCTTTCTGG - Intergenic
938399125 2:130974250-130974272 CAACAGAGTGAGATCTTGTCTGG + Intronic
938413351 2:131083922-131083944 CGACAGAGCGAGACTCCGTCTGG - Intronic
938413858 2:131088224-131088246 CAACAGAGCAAGACTCTGTCTGG + Intronic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938760583 2:134422136-134422158 CAACAGAGCAAGACCCTTTGGGG + Intronic
938894124 2:135733938-135733960 CAACAGAGCGAGACGCCGTCTGG + Intergenic
938900558 2:135795756-135795778 GGACAGGGCGAGACCCTGTCTGG - Intronic
938957794 2:136314819-136314841 CAACAGAGTGAGACGCCTTCTGG - Intergenic
939531294 2:143364984-143365006 CAACAGAGCGAGACTCTGTGTGG + Intronic
939805279 2:146768431-146768453 CAACTCAGTAAGACCCTGTCAGG - Intergenic
939896256 2:147794396-147794418 TGACAGAGAGAGACTCTGTCTGG + Intergenic
940304134 2:152207607-152207629 CAACAGAGCCAGACTCTGTGTGG - Intergenic
940509842 2:154599298-154599320 CGACAGAGCAAGACTCTGTCTGG + Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941952529 2:171171332-171171354 TGACACAGTGAGACCCTGTCTGG + Intronic
941956024 2:171205340-171205362 TAACAGAGCAAGACCCTGTTGGG - Intronic
942316565 2:174701781-174701803 TGACAGAGCGAGACACTGTCTGG + Intergenic
942465343 2:176202226-176202248 CGACAGAGTGAGACCCCATCTGG - Intergenic
942654269 2:178198320-178198342 CGACAGAGCGAGATTCTGTCTGG - Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
943753500 2:191534853-191534875 AAACAGTGGGAGACTCTGTGTGG + Intergenic
944446196 2:199792675-199792697 CATCAGAGGGAAATGCTGTCAGG - Intronic
944565386 2:200985089-200985111 CAACAGAGTGAGACCATCTGGGG + Intronic
944576487 2:201095887-201095909 CAACATAGCAAGACACTGTCTGG - Intergenic
944704973 2:202279772-202279794 CAACAGAGCGAGACTCCTTCTGG + Intronic
944717167 2:202386698-202386720 CGACAGAGCAAGACTCTGTCTGG - Intronic
945094765 2:206208657-206208679 TGACAGAGTGAGACCCTGCCTGG - Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945280800 2:208033664-208033686 CAACAGAGTGAGACTCCATCTGG + Intergenic
945388094 2:209228433-209228455 TGACAGAGTGAGACTCTGTCTGG - Intergenic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946221078 2:218227608-218227630 CGACAGAGCAAGACGCTGTCTGG - Intronic
946231426 2:218293603-218293625 TGACAGAGCGAGACCCTGTCTGG - Intronic
947078066 2:226365845-226365867 CGACAGAGTGAGACTCTATCTGG - Intergenic
947173623 2:227338022-227338044 CAACACAATGAGACCCTATCTGG + Intronic
947297178 2:228643894-228643916 CGACAGAGTGAGACTCTGTCTGG + Intergenic
947442542 2:230135919-230135941 CAACAGAGTGAGATCCTGTGTGG - Intergenic
947487159 2:230561826-230561848 TGACAGAGTGAGACTCTGTCTGG + Intergenic
947505174 2:230703285-230703307 CAACAGAGTGAGACTCTGTCTGG - Intergenic
947562918 2:231173504-231173526 CAACAGGGCAAGACCCTGTCTGG + Intergenic
947723772 2:232384391-232384413 CAACAGAGCAAGACCCTGTCTGG + Intergenic
947777891 2:232728996-232729018 CAACAGAGCCAGACCCAGTAAGG - Intronic
948008826 2:234634258-234634280 CGACAGAGCTAGACTCTGTCGGG - Intergenic
948057625 2:235020475-235020497 TGACAGAGCAAGACCCTGTCTGG + Intronic
948212897 2:236208193-236208215 CCACAGAGGGAGTGCCTGGCAGG + Intronic
948742884 2:240059513-240059535 CGACAGAGCAAGACTCTGTCTGG + Intergenic
949027450 2:241773283-241773305 TGACAGAGCGAGACCCTCTCTGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169169617 20:3454270-3454292 CAACAGAGAGAGACCCTGTCTGG - Intergenic
1169419898 20:5451471-5451493 CAACAGAGTGAGACTCTGTTGGG + Intergenic
1169454682 20:5741838-5741860 CAACAGAGTGAGACCGTATCCGG + Intergenic
1170249010 20:14258960-14258982 TAACAGAGCAAGACTCTGTCTGG - Intronic
1171546508 20:26006117-26006139 TGACAGAGTGAGACCCTGTCTGG - Intergenic
1172159479 20:32856380-32856402 TGACAGAGCGAGACCCTGCCTGG - Intergenic
1172411570 20:34727741-34727763 CGACAGAGTGACACTCTGTCTGG - Intronic
1172551661 20:35805216-35805238 CAACAGAATGAGACCTTGTCTGG - Intronic
1172579782 20:36037616-36037638 AGACAGAGTGAGACCCTATCTGG - Intergenic
1172710103 20:36915316-36915338 TAACACAGCAAGACCCTGTCTGG + Intronic
1173005151 20:39134564-39134586 AAGCAGAGGGAGCCCCTGTCTGG + Intergenic
1173008381 20:39158360-39158382 CAACACAGTGAGACCCTGTCTGG - Intergenic
1173125813 20:40335090-40335112 CTAAAGTGGAAGACCCTGTCTGG - Intergenic
1173681036 20:44882035-44882057 CAACAGAGTGAGACTCTCTCTGG + Intergenic
1173729832 20:45320356-45320378 TGACAGAGGGAGACCCTTTGGGG + Intergenic
1173945247 20:46945094-46945116 TGACAGAGTGAGACCTTGTCTGG + Intronic
1174014334 20:47475613-47475635 CAACAGAGTGAGACTCTGTTGGG + Intergenic
1174042968 20:47713019-47713041 TAACAGAGCCAGACCCTGTCTGG + Intronic
1174485745 20:50860114-50860136 CGACAGAGTGAGATCCTGCCTGG + Intronic
1174585767 20:51606876-51606898 AAACAGAGTGAGACCCTGGGTGG - Intronic
1174602119 20:51733391-51733413 CAACAGAATTAGACTCTGTCTGG - Intronic
1174610376 20:51793439-51793461 TGACAGAGTGAGACCCTGTCTGG + Intronic
1174825178 20:53762253-53762275 CAACAGAGTGAGACCCTGTCAGG - Intergenic
1175235331 20:57506321-57506343 CAACAGAGCGAGACTGTCTCAGG - Intronic
1175709630 20:61208982-61209004 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1175848833 20:62075897-62075919 CAACAGAGTGAAACTTTGTCTGG + Intergenic
1175884927 20:62284394-62284416 CAACAGAGGGAGACCCTGCCTGG - Intronic
1175970003 20:62680922-62680944 TGACAGAGTGAGACCCTGTCTGG - Intronic
1176969391 21:15248368-15248390 CAACAGAGTGACATCCTGTCTGG - Intergenic
1177608882 21:23420195-23420217 CAAGAGATAGAGACCCAGTCTGG - Intergenic
1177846596 21:26296048-26296070 CAACAGAATGAGACTCTGTCTGG - Intergenic
1178608703 21:34061073-34061095 CAAAAGAGTGAAACTCTGTCTGG + Intergenic
1178614168 21:34116025-34116047 TAACAGAGTGAAACCCTGTCGGG - Intronic
1178628303 21:34236858-34236880 CAACAAAATGAGACTCTGTCTGG + Intergenic
1179208355 21:39304592-39304614 CAACAAAGTGAGAACTTGTCTGG + Intronic
1179457543 21:41509297-41509319 CAACAGAGTGAGACCCCTTCTGG - Intronic
1179530729 21:42017499-42017521 TGACAGAGTAAGACCCTGTCTGG - Intergenic
1179663836 21:42896001-42896023 CAACAGAGTGAGACTGTCTCAGG - Intronic
1179792790 21:43765036-43765058 TGACAGAGTGAGAACCTGTCTGG - Intergenic
1179836852 21:44040631-44040653 TGACAGAGCGAGACCCTGTAAGG - Intronic
1180166175 21:46031104-46031126 CCACAGAGTGAGACTCTGTCGGG - Intergenic
1180253121 21:46602772-46602794 GAACAGAGAGGGACCCTGTGGGG - Intronic
1180608444 22:17079475-17079497 TGACAGAGTGAGACTCTGTCTGG + Intergenic
1180847041 22:18989198-18989220 CAACAGAGCAAGAACCTGTCTGG + Intergenic
1180915704 22:19484956-19484978 AAACAGAGAGAGACCCCGTCTGG - Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181754762 22:25016038-25016060 CAACAGAGCGAGACTCCGTCTGG - Intronic
1181776672 22:25164926-25164948 CAACAGAGTGAGACTGTCTCGGG + Intronic
1182127936 22:27829828-27829850 TCACAGAGGGAGGGCCTGTCTGG - Intergenic
1182139903 22:27944921-27944943 CGACAGAGCGAGACCCTCTGGGG + Intergenic
1182221646 22:28763466-28763488 CAACAGAGCAAGACCCTGCCTGG + Intergenic
1182231779 22:28842947-28842969 CAACAGAGCAAGACTCTGTCTGG + Intergenic
1182234795 22:28866760-28866782 TGACAGAGGGAGACCCTGTTAGG + Intergenic
1182340346 22:29615162-29615184 CAACAAAGCAAGACTCTGTCTGG + Intronic
1182373589 22:29829677-29829699 CGACAGAGCAAGACTCTGTCTGG + Intronic
1182479963 22:30601790-30601812 AAACAGAGCGAGACTGTGTCTGG - Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182655889 22:31889567-31889589 CAACAGAGCGAGACTCTGTCTGG - Intronic
1182686566 22:32124795-32124817 CAATAGAGCAAGACTCTGTCTGG - Intergenic
1182979636 22:34656970-34656992 CAACAGAGTGAGACTCCTTCTGG - Intergenic
1183647720 22:39136068-39136090 CGACAGAGCGAGACTCTGTCTGG + Intronic
1183793690 22:40097323-40097345 AAACAGAGAAAGACCCTGTCTGG - Intronic
1183845922 22:40539927-40539949 CAACAGAGTGAGACCCTGTCTGG - Intronic
1183879887 22:40818684-40818706 CAACAGAGCAAGACCCTGTCCGG + Intronic
1183945585 22:41324048-41324070 CGACACAGCGAGACTCTGTCTGG + Intronic
1184200351 22:42964396-42964418 CGACAGAGCGAGACTCCGTCTGG + Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184513904 22:44948669-44948691 TGACAGAGTGAGACTCTGTCTGG + Intronic
949152881 3:791680-791702 TGACAGAGTGAGACTCTGTCTGG + Intergenic
949181107 3:1132537-1132559 CAACATAGAAAGACCCTGTTTGG + Intronic
949268650 3:2188823-2188845 AAACAAAGGGAGACTCTGTTGGG + Intronic
949836851 3:8279263-8279285 GAAAAGAGGGAGACCGTGTAAGG + Intergenic
950001387 3:9659208-9659230 CAACAGAGGAAGACCTTGTTGGG + Intronic
950082743 3:10235030-10235052 CCACAGAGGGAGAACCTGATTGG + Intronic
950211015 3:11123357-11123379 CAACAGAGCAAGACCCTGTCTGG + Intergenic
950308718 3:11937180-11937202 CAACAGAATGAGACCCTGTCTGG - Intergenic
950383015 3:12633461-12633483 CAACAGAGGGAGACCCTGTCTGG + Intronic
951574401 3:24099284-24099306 CAACAGGAAGAGACACTGTCTGG - Intergenic
952171120 3:30808010-30808032 CAACAGAGAGAGACCCCTTCGGG + Intronic
952303341 3:32124083-32124105 CTACAGAGGAAGACTCTGTCTGG - Intronic
952368203 3:32693559-32693581 TGACAGAGTGAGACCCTGTCTGG - Intronic
952433352 3:33247505-33247527 AGACAGAGGAAGACCCTGTCTGG - Intergenic
952768727 3:36977725-36977747 TGACAGAGGGAGACCCTGTCAGG + Intergenic
952792951 3:37214760-37214782 TAACAGAGTGAGACCCTGTCTGG + Intergenic
953306680 3:41837581-41837603 TGACAGAGTGAGACTCTGTCTGG - Intronic
953365800 3:42343875-42343897 CAACAGAGCGAGACTCTGTCTGG - Intergenic
953552639 3:43915929-43915951 CAACGGAGCAAGACTCTGTCTGG - Intergenic
953752694 3:45621248-45621270 CAACAGAGCAAGACCCTGTAAGG - Intronic
953889067 3:46736994-46737016 TGACAGAATGAGACCCTGTCTGG - Intronic
954058602 3:48049916-48049938 CAACAGAGTGAGACTTCGTCTGG + Intronic
954070877 3:48142075-48142097 CGACAAAGCGAGACTCTGTCTGG - Intergenic
954254295 3:49393324-49393346 TGACAGAGGCAGACCCTCTCTGG - Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954526007 3:51271829-51271851 CAACAGAGCGAGACTGTCTCAGG + Intronic
954678712 3:52329803-52329825 CAACAGAGTGAGACTCCATCTGG + Intronic
955328406 3:58027170-58027192 TGACAGAGGGAGACCCTGTCTGG - Intronic
955361060 3:58275347-58275369 TGACAGAGTGAGACTCTGTCTGG - Intronic
955793302 3:62610067-62610089 TGACAGAGTGAGACCCTTTCTGG + Intronic
956101736 3:65775427-65775449 CAACAGAGTGAGACCTTCTCTGG + Intronic
956796474 3:72722831-72722853 CCCCAGAGTGAGATCCTGTCTGG + Intergenic
956863453 3:73347269-73347291 TGACAGAGCGAGACTCTGTCAGG - Intergenic
957305343 3:78450831-78450853 CAAGAGAGGGAGAAGGTGTCAGG + Intergenic
957924256 3:86788494-86788516 AGACAGAGTGAGAACCTGTCTGG - Intergenic
958264655 3:91423952-91423974 CAACATAGCAAGACCTTGTCTGG - Intergenic
958487310 3:94729239-94729261 CAACATAGGGAGACCCAGGCTGG + Intergenic
958608675 3:96395080-96395102 TGACAGAGTGAGACTCTGTCTGG - Intergenic
958930361 3:100201447-100201469 CGACAGAGCAAGACTCTGTCTGG - Intergenic
959332829 3:105027419-105027441 CAACAGAGTGAGACTCTATCTGG - Intergenic
959374005 3:105565008-105565030 CAACAGAGCAAGACTCTGTCTGG + Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960605380 3:119499111-119499133 CGACAGAGCAAGACCCTGTCTGG - Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961143274 3:124573519-124573541 TAATAGAGTGAGACCCTGTCTGG - Intronic
961186686 3:124921167-124921189 CAACAGAGTGAGACTCTGCCTGG - Intronic
961368408 3:126415429-126415451 AGACTGAGGGGGACCCTGTCGGG - Intronic
961597596 3:128030980-128031002 TGACAGAGAGAGACCCTGTCTGG - Intergenic
961896121 3:130169085-130169107 TGACAGAGTGAGACCCTGTATGG + Intergenic
961952414 3:130763272-130763294 ACACAGAGGGAGACTCTGTTAGG + Intergenic
963810162 3:149768559-149768581 CAACAGAGCAAGACTCTGTCTGG - Intronic
963893712 3:150663472-150663494 CAACAGAGCAAGACCCTGTTAGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964113216 3:153108321-153108343 CAACAGAGTGAGACTCCGTCTGG + Intergenic
964356506 3:155855886-155855908 CGACAGAGTGAGACTCCGTCTGG + Intergenic
964621623 3:158724843-158724865 TAACATAGTGAGACCCTGTCTGG - Intronic
964622320 3:158730443-158730465 CAACAGAGTGAGACCCTATGGGG - Intronic
964891903 3:161546738-161546760 CAATAGAGTGAGATCCTCTCTGG - Intergenic
964976952 3:162633571-162633593 TGACAGAGTGAAACCCTGTCTGG - Intergenic
965724613 3:171700971-171700993 CAGCAGAGGTAGACTATGTCAGG + Intronic
965770175 3:172173798-172173820 CAACAGAGCAAGACCCTGTCTGG + Intronic
966176021 3:177138570-177138592 TGACAGAGCAAGACCCTGTCTGG + Intronic
966528874 3:180951201-180951223 TGACAGAGTGAGACCCTGTCTGG + Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
966820605 3:183921405-183921427 CAAAAGAAGGAGACGCCGTCAGG + Intronic
966872047 3:184297112-184297134 CGACAGAGCGAGACTCCGTCTGG + Intronic
966906391 3:184528921-184528943 TGACAGAGCAAGACCCTGTCTGG + Intronic
967058654 3:185851967-185851989 CGACAGAGAGAGACCCTGTGTGG + Intergenic
967228744 3:187317950-187317972 TGACAGAGCAAGACCCTGTCAGG - Intergenic
967478656 3:189949394-189949416 CAACATATGGAGATACTGTCAGG - Intergenic
967626518 3:191692015-191692037 CAACAGGGCAAAACCCTGTCTGG + Intergenic
967798957 3:193632836-193632858 CAATAGAGCAAGACCCTGTCTGG + Intronic
968036346 3:195551333-195551355 CAATAGAGTGAGACTCAGTCTGG + Intergenic
968130163 3:196188557-196188579 CAACAGAGTGAGACTCCATCTGG - Intergenic
968326213 3:197819104-197819126 CAACAGAGTGAGATTCCGTCTGG + Intronic
968414774 4:421585-421607 TAACAAAGCAAGACCCTGTCTGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969112016 4:4850150-4850172 CAACAGAGTGAGACCCTGTCTGG + Intergenic
969397539 4:6932349-6932371 CGACAGAGCAAGACTCTGTCTGG + Intronic
969589679 4:8114693-8114715 GAACAGAGGGCCGCCCTGTCTGG - Intronic
969595270 4:8145201-8145223 CGACAGAGCGAGACTCTGTCTGG - Intronic
969656270 4:8500474-8500496 CAACAGAGCGAGACTCCCTCTGG + Intergenic
970081997 4:12298022-12298044 CAACAGAGTGAGACTGTCTCAGG - Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971326496 4:25648546-25648568 CAACACACGGAGAGCCTGCCGGG - Intergenic
971782634 4:31056346-31056368 TGACAGAGAGAGACCCTGACAGG + Intronic
971849191 4:31961328-31961350 CCACAGAGTGAGACTCTGTCTGG - Intergenic
972090049 4:35270016-35270038 CAATAGAGTGAGACCTTGTCTGG - Intergenic
972425189 4:38926472-38926494 CAACAGAATGAGACTCTATCTGG - Intronic
972516177 4:39812684-39812706 CAACAGAGTGAGACCCCATATGG + Intergenic
972528578 4:39940197-39940219 TGACAGAGCGAGACCCTGTCTGG + Intronic
972531182 4:39962774-39962796 CAACAGAGCGAGACTCCGTCTGG + Intronic
972646606 4:40973869-40973891 CGACAGAGTGAGACTCTGTCTGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973111407 4:46402594-46402616 AAAAAGAGTGAGACACTGTCAGG - Intronic
973134612 4:46690791-46690813 TGACAGAGTGAGACCCTTTCTGG - Intergenic
973160255 4:47007118-47007140 TGACAGAGCGAGACCCTGTTTGG + Intronic
973677545 4:53280494-53280516 CGACAGAGGGAAACTCTGTCTGG + Intronic
974148416 4:57974513-57974535 CGACAGAGCGAGACTCTGTCTGG - Intergenic
974501249 4:62706337-62706359 GAACAGAGCAAGACGCTGTCAGG + Intergenic
975068513 4:70100924-70100946 CGACAGAGCGAGACTCTGTCTGG + Intergenic
975181858 4:71355192-71355214 GAATAGAGGGAGGCCCTGCCAGG + Intronic
975512659 4:75210900-75210922 CCACAGAGGGAGAACCTGAGAGG - Intergenic
975581704 4:75912532-75912554 TGACAGAGGGAGACTCTGTCTGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976155149 4:82136060-82136082 TGACAGAGTGAGACTCTGTCTGG + Intergenic
976302508 4:83528637-83528659 TGACAAAGTGAGACCCTGTCTGG + Intergenic
976595313 4:86890144-86890166 TGACAGTGTGAGACCCTGTCAGG + Intronic
976608170 4:87002121-87002143 CAACAGAGCAAGACCGTCTCTGG - Intronic
976664666 4:87577698-87577720 CAACAGAGCAAGACTCTGTCTGG - Intergenic
977697812 4:99986153-99986175 CAACAGAGTGAGACTCTGTCTGG + Intergenic
977938709 4:102834727-102834749 TGACAGAGTGAGACCCTGTCTGG + Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978578731 4:110211820-110211842 CATCAGAGAGAGACCATGACTGG + Intergenic
978991087 4:115083438-115083460 TGACAGAGGGATACCCTGTCTGG + Intronic
979230517 4:118343734-118343756 CAACAAAGAAAGACCCTGTGGGG + Intronic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979319079 4:119301405-119301427 CAACAGAGCGAGACTCCATCTGG + Intronic
979801135 4:124910460-124910482 TGACAGAGTGAGACCTTGTCTGG - Intergenic
980677613 4:136109554-136109576 TGACAGAGGGAGTCTCTGTCTGG - Intergenic
980773088 4:137404316-137404338 CAACAGAGCGAAACTCCGTCTGG - Intergenic
980773509 4:137409539-137409561 TGACAGAGCGAGACTCTGTCTGG - Intergenic
981094510 4:140764412-140764434 TGACAGAGGGAGGCCCTGTCTGG + Intergenic
981759516 4:148178309-148178331 CAACAGAGTGAGACTCTGTCTGG + Intronic
981806762 4:148724994-148725016 CAACATAGGGAGACCCCGTCTGG - Intergenic
981923473 4:150112828-150112850 CAACAGAAAAAGACTCTGTCCGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982178301 4:152727260-152727282 TAACAGAGTGAGACACTGTTTGG - Intronic
982328662 4:154157199-154157221 CAACAGAGTGAGACCATCTCCGG - Intergenic
982453410 4:155578777-155578799 CTACAGAGTGAGACTCTGTCTGG + Intergenic
983467423 4:168112276-168112298 CAGCAGAGCAAGACTCTGTCTGG + Intronic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
983780667 4:171666402-171666424 CAACAGAGTGACACCCTGTCTGG + Intergenic
984237094 4:177172917-177172939 CAATACAGCAAGACCCTGTCTGG - Intergenic
984482821 4:180327448-180327470 CGACAGAGTGAGACCCCATCTGG + Intergenic
984712168 4:182895094-182895116 CAACAGAACGAGACCCAGTCTGG - Intronic
984718912 4:182952281-182952303 CAATAGAGGGAGAGCGTGGCAGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984927918 4:184822718-184822740 CGACAGAGTGAGACCTTATCTGG + Intronic
984950999 4:185007735-185007757 CAACAGAGCAAGACTCCGTCTGG - Intergenic
985753353 5:1696668-1696690 TGACAGAGCGAGACCCTGTGGGG + Intergenic
986231194 5:5866187-5866209 CAACAGAGCAAGACCCTGTTTGG - Intergenic
986328896 5:6703024-6703046 CAACAGAATAAGGCCCTGTCTGG - Intergenic
986874668 5:12093730-12093752 CAACAGAGTGAAACTCTGTTGGG + Intergenic
987071424 5:14340375-14340397 CAACAGAGCAAGACTCCGTCTGG + Intronic
987376507 5:17240236-17240258 CAACAGAGTGAGGCTCTGGCCGG + Intronic
987710674 5:21498149-21498171 CAACAGAACAAGACCCTGTCAGG - Intergenic
987916601 5:24223293-24223315 CACTAGAGCGAGACTCTGTCTGG - Intergenic
988502761 5:31797431-31797453 CAACAGAGTGAAACCCTGTCTGG + Intronic
989017502 5:36956208-36956230 CAACAGAGTAAGACTCCGTCTGG + Intronic
989042318 5:37241644-37241666 TGACAGAGTGAGACCCTGTCTGG - Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990173900 5:53085926-53085948 CAACAGAGCAAGGCTCTGTCTGG - Intronic
990556828 5:56944709-56944731 TGACAGACTGAGACCCTGTCTGG - Intronic
990902652 5:60770029-60770051 TGACAGAGCGAGACCCTTTCTGG + Intronic
991193341 5:63902082-63902104 TGACAGAGGGAGACTCTGTCTGG - Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991458949 5:66836149-66836171 TGACAAAGTGAGACCCTGTCTGG + Intronic
991676307 5:69092848-69092870 CAACAGAGCAAGACCGTCTCTGG - Intergenic
991761012 5:69917212-69917234 CAACAGAACAAGACCCTGTCAGG - Intergenic
991786318 5:70200889-70200911 CAACAGAACAAGACCCTGTCAGG + Intergenic
991840241 5:70792263-70792285 CAACAGAACAAGACCCTGTCAGG - Intergenic
991878762 5:71201274-71201296 CAACAGAACAAGACCCTGTCAGG + Intergenic
992199380 5:74368766-74368788 TGACAGAGTGAGACTCTGTCTGG - Intergenic
992420104 5:76595272-76595294 CAATAGAATAAGACCCTGTCCGG - Intronic
992436593 5:76760705-76760727 CAACAGAGCAAGATTCTGTCTGG + Intergenic
992440762 5:76795819-76795841 TGACAGAGCAAGACCCTGTCTGG + Intergenic
992560080 5:77942817-77942839 CAATAGAGCAAGACCCTGTCTGG + Intergenic
992739112 5:79755304-79755326 CGACAGAGTGAGACTCTGTGTGG - Intronic
992810024 5:80377374-80377396 CAACACAGCAAGACTCTGTCTGG + Intergenic
992821672 5:80504011-80504033 CAAGAGAGGGAGACCTGGCCTGG - Intronic
992971262 5:82060830-82060852 TGACAGAGTGAGACCTTGTCTGG + Intronic
993330623 5:86595343-86595365 AAACAGAGCAAGACCCTGTCTGG + Intergenic
994061549 5:95484364-95484386 CAACAGAATGAGATCCTGTCTGG - Intronic
994196822 5:96931174-96931196 CAACAGAGTGAGATCCTGTCTGG - Intronic
994301593 5:98154517-98154539 CAACAGAGCAAGACTCTGACTGG + Intergenic
995146722 5:108795295-108795317 AGCCAGAGGGAGACCCTGTCTGG + Intronic
995415438 5:111906976-111906998 CAGGAGTTGGAGACCCTGTCTGG - Intronic
995522320 5:113021346-113021368 GAACAGAGCAAGACTCTGTCTGG + Intergenic
995864710 5:116678770-116678792 CAACAGAGAGAGACTCTGTCTGG - Intergenic
996164575 5:120209385-120209407 CAACAGAGTGAGACTGTGCCTGG + Intergenic
996378255 5:122838137-122838159 TGACAAAGTGAGACCCTGTCTGG + Intergenic
997483025 5:134203739-134203761 CGACAGAGTGAGATCCTATCTGG - Intronic
997958463 5:138299171-138299193 TTACAGAGGGAGACTCTGTCTGG + Intronic
998049134 5:139016864-139016886 TGACAGAGTGAGGCCCTGTCAGG - Intronic
998076792 5:139243149-139243171 CAAAAGAGTGAGACCTTGGCTGG + Intronic
998659166 5:144216822-144216844 CCACAGAGGGAGACTCTGTCTGG + Intronic
998725338 5:145006521-145006543 CAACAGAGCGAGATGCTGTCTGG - Intergenic
998827249 5:146115021-146115043 CAACAGAGCAAGATTCTGTCGGG + Intronic
998835399 5:146198200-146198222 CAACAGAGCAAGACTCTTTCGGG - Intergenic
1000059920 5:157645640-157645662 CAACAGAGTGAGACCCTGTCTGG + Intronic
1000294237 5:159899125-159899147 TGACAAAGTGAGACCCTGTCAGG + Intergenic
1000610470 5:163368053-163368075 TGACAGAGCCAGACCCTGTCTGG + Intergenic
1000625156 5:163529918-163529940 CAACAGACCAAGACCCTGTCTGG + Intergenic
1001472820 5:172026951-172026973 TGACAGAGCGAGACCCTGTCAGG - Intergenic
1002069231 5:176669206-176669228 CATCAGAGTGAGGCCCTGGCTGG + Intergenic
1002308991 5:178303018-178303040 CAACAGAGCTAGACTCTGTCAGG - Intronic
1002320487 5:178372590-178372612 CAATAGAGAGAGACTTTGTCTGG - Intronic
1002490333 5:179571482-179571504 CAACAGAGCCAGACTCTGTCTGG + Intronic
1002807367 6:590093-590115 CGACAAAGCGAGACTCTGTCTGG + Intronic
1002948976 6:1789553-1789575 TAACAGAGCAAGAGCCTGTCAGG - Intronic
1003577051 6:7306895-7306917 CGACAGAGCGAGACTCTGTCTGG + Intronic
1003595710 6:7472442-7472464 CAACAGAGCAAGACTCTGTCTGG - Intergenic
1003652379 6:7973332-7973354 CGACAGAGCAAGACTCTGTCTGG - Intronic
1003878865 6:10462386-10462408 CAGCAGAGCAAGACCATGTCTGG + Intergenic
1004072254 6:12311293-12311315 CAACAGAGGGAGTCCTTGTAAGG + Intergenic
1004149936 6:13107135-13107157 CAACAGAGCAAGAGTCTGTCTGG - Intronic
1004476078 6:15973510-15973532 CAACAAAGTGAGACTCTGTCTGG - Intergenic
1004678136 6:17864406-17864428 CAACAGAGAGAGCTCCTGTATGG + Intronic
1005082823 6:21973990-21974012 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1005400685 6:25430447-25430469 CAACAGTGCGAGACCCTGTCTGG - Intronic
1005515103 6:26547254-26547276 AGACAGAGTGAGACTCTGTCTGG - Intergenic
1005547013 6:26882361-26882383 CAACAGAACAAGACTCTGTCAGG + Intergenic
1005570862 6:27144440-27144462 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1005903931 6:30243881-30243903 CAACAGAGGGAGGACAGGTCCGG + Intergenic
1006259912 6:32859030-32859052 TGACAGAGAGAGACCCTGTCTGG + Intronic
1006475279 6:34248995-34249017 CAACCGAGGGCGTTCCTGTCGGG - Exonic
1006548425 6:34799468-34799490 TGACAGAGTGAGACCCTGTCTGG + Intronic
1006755237 6:36409804-36409826 TGACAGAGCAAGACCCTGTCTGG + Intronic
1006885621 6:37379931-37379953 CGACAGAGTGAGACACTGTCTGG - Intronic
1007542500 6:42660945-42660967 CAACGGAGCGAGACCCTGTGTGG + Intronic
1007611554 6:43152505-43152527 CGACAGAGTGAGACTCCGTCTGG + Intronic
1007792582 6:44320127-44320149 CAACAGAGCGAGACTCTGTCTGG + Intronic
1008132766 6:47737747-47737769 CGACAGAGCAAGACTCTGTCTGG - Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008826530 6:55701454-55701476 TGACAGAGCGAGACTCTGTCTGG - Intergenic
1008990732 6:57598699-57598721 CAACATAGCAAGACCTTGTCTGG + Intronic
1009017772 6:57923438-57923460 CAACAGAACAAGACCCTGTCAGG + Intergenic
1009907217 6:69884874-69884896 CAACAGAGCGAGACTCAGTCTGG - Intronic
1010214933 6:73393275-73393297 TAACATAGTGAGACCCTGCCGGG - Intronic
1010245051 6:73654508-73654530 CAACAGAGCAAGACCCTGCCTGG - Intergenic
1010430367 6:75771020-75771042 CAACAAAGTGAGACCATCTCAGG - Intronic
1011075508 6:83434323-83434345 CAACAGCGTGAGACTCTGTTGGG - Intergenic
1011719900 6:90144523-90144545 CAAAAAAGGGAGATCCTGGCTGG + Intronic
1012261350 6:97091187-97091209 CAATAGAGCGAGACCCTGTCTGG + Intronic
1012555161 6:100502523-100502545 AAACAGAGCAAGACTCTGTCTGG + Intergenic
1013019520 6:106198754-106198776 TGACAGAGCGAGACCCTGTCTGG + Intronic
1013209023 6:107970338-107970360 CCAGAGAGTGAGACCCTGTCTGG - Intergenic
1013266247 6:108502044-108502066 CAACAGAGTGAGACTCTGTCTGG - Intronic
1013377370 6:109530825-109530847 CAACAGATCGAGACCATATCTGG - Intronic
1013435319 6:110099243-110099265 GGGCAGAGTGAGACCCTGTCTGG - Intergenic
1013931124 6:115534392-115534414 CAACAGAGTGAGACCCCGTCTGG - Intergenic
1014319710 6:119911771-119911793 TGACAGAGCGAGACTCTGTCTGG + Intergenic
1015116353 6:129654021-129654043 TGACAGAGCGAGACCCTGTCTGG + Intronic
1015338889 6:132074789-132074811 CAACAGAGCAAGACTCTGTCTGG - Intergenic
1015764361 6:136700052-136700074 TGACAGAGCGAGACTCTGTCAGG + Intronic
1015950417 6:138547398-138547420 CAACAGAGTGAGACCCTCTCAGG - Intronic
1016381874 6:143492386-143492408 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1016802875 6:148184290-148184312 TGACAGAGCCAGACCCTGTCTGG - Intergenic
1016827364 6:148400729-148400751 CGACAGAGTGAGACTTTGTCTGG + Intronic
1017047217 6:150357954-150357976 CAACTGAGAGAGACACTGGCTGG - Intergenic
1017096560 6:150810287-150810309 TGACAGAGTGAGACCCTGTCTGG - Intronic
1017290336 6:152728142-152728164 CAACAGAGTGAGCCTCTGTCTGG + Intergenic
1017471713 6:154744270-154744292 CAACAGAGCAAGACTCTGGCTGG + Intronic
1017566995 6:155697989-155698011 TGACAGAGTGAGACACTGTCTGG + Intergenic
1017936527 6:159010345-159010367 TGACAGAGTGAGACCCTGTCAGG - Intergenic
1018086513 6:160305544-160305566 CAACTGAGCAAGACCCTGTCTGG + Intergenic
1018359959 6:163057433-163057455 TGACAGAGTGAGACTCTGTCTGG - Intronic
1018693601 6:166370809-166370831 CAACAGAGCAAGACCCTGTCTGG + Intronic
1019183615 6:170208302-170208324 CAAAGGAGTGAGCCCCTGTCTGG - Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019568415 7:1696409-1696431 TGACAGAGGGAGACCATCTCTGG - Intronic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019720638 7:2568509-2568531 GAGCAAAGGGAGACCCTGTCTGG - Intronic
1019822621 7:3256861-3256883 CAACAGAGTGAAGCCCTGTCTGG + Intergenic
1020052335 7:5090119-5090141 CAACAGAATGAGACCCTCTTTGG - Intergenic
1020095240 7:5364782-5364804 CAACAGAGGGAGGCTGTCTCAGG + Intronic
1020115124 7:5471925-5471947 CAACACAGTAAGACCCTGTGTGG + Intronic
1020185065 7:5952757-5952779 CAACAGAGAAAGACTCCGTCTGG - Intronic
1020213923 7:6174565-6174587 CAGCAGAGCGAGACTCTGTCTGG - Intronic
1020326823 7:6980717-6980739 TGTCAGAGTGAGACCCTGTCTGG + Intergenic
1020628348 7:10610560-10610582 CAACAGAGCGAGACTGCGTCTGG - Intergenic
1021443997 7:20713251-20713273 TAACAAAATGAGACCCTGTCTGG - Intronic
1021703209 7:23340867-23340889 CGACAGAGCGAAACTCTGTCTGG - Intronic
1021712900 7:23434056-23434078 AGACAGAGTGAGACTCTGTCTGG + Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1023016632 7:35974903-35974925 CAACGAAGCAAGACCCTGTCTGG - Intergenic
1023387592 7:39675711-39675733 CAACAGAGTGAGACCATGTCTGG + Intronic
1023476729 7:40587920-40587942 CGGCAGAGTGAGACTCTGTCTGG - Intronic
1023975983 7:45030454-45030476 AAACAGAGTGAGACCCTGTCTGG - Intronic
1024034374 7:45495162-45495184 CCCCATAGGGAGACCCTGCCCGG + Intergenic
1024257188 7:47547918-47547940 CGACAGAGTGAGACTCCGTCAGG - Intronic
1024350834 7:48361074-48361096 CAACAGAGTGAGACCCTGTTTGG + Intronic
1024625289 7:51203019-51203041 TGACAGAGCGAGACTCTGTCTGG + Intronic
1025241354 7:57278827-57278849 CGACAGAGCGAGACTCTGTCTGG - Intergenic
1025848813 7:65225421-65225443 TGACAGAGGGAGATCCTTTCTGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026004024 7:66586734-66586756 CGACAGAGTGAGACTCAGTCTGG - Intergenic
1026068255 7:67095016-67095038 CAACAGGACAAGACCCTGTCTGG - Intronic
1026090434 7:67295213-67295235 AGACAGAGTAAGACCCTGTCTGG - Intergenic
1026340643 7:69431178-69431200 TGACAGAGTGAGATCCTGTCTGG - Intergenic
1026460466 7:70610453-70610475 CAACAGAATGAGACTCTGTCAGG - Intronic
1026472946 7:70709690-70709712 CAACAGAGCAAGATTCTGTCTGG + Intronic
1026503051 7:70959298-70959320 TGACAGAGTGAGACACTGTCTGG - Intergenic
1026629562 7:72026563-72026585 CGACAGAGCAAGACTCTGTCTGG + Intronic
1026708666 7:72717279-72717301 CAACAGGGCAAGACCCTGTCTGG + Intronic
1026746000 7:73013646-73013668 AGACAGAGTAAGACCCTGTCTGG + Intergenic
1026749653 7:73041790-73041812 AGACAGAGTAAGACCCTGTCTGG + Intergenic
1026753301 7:73069900-73069922 AGACAGAGTAAGACCCTGTCTGG + Intergenic
1026756952 7:73097936-73097958 AGACAGAGTAAGACCCTGTCTGG + Intergenic
1026834885 7:73632007-73632029 TGACTGAGGGATACCCTGTCTGG - Intergenic
1026835656 7:73637453-73637475 TGACAGAGTGAGACTCTGTCTGG + Intergenic
1026878423 7:73893256-73893278 CACCTGATGGAGACCCGGTCTGG - Intergenic
1026954097 7:74365964-74365986 CAACATAGCGAGACCCTGCCTGG - Intronic
1026956466 7:74379307-74379329 CAACAGAGGGAGACTCCGTCTGG + Intronic
1026965957 7:74440241-74440263 CAAAAGAGCGAGACCCCATCTGG + Intergenic
1027032105 7:74898205-74898227 AGACAGAGTAAGACCCTGTCTGG + Intergenic
1027045850 7:74991052-74991074 TGACAGAGCAAGACCCTGTCTGG + Intronic
1027090454 7:75295550-75295572 AGACAGAGTAAGACCCTGTCTGG - Intergenic
1027094099 7:75323478-75323500 AGACAGAGTAAGACCCTGTCTGG - Intergenic
1027097742 7:75351445-75351467 AGACAGAGTAAGACCCTGTCTGG - Intergenic
1027198895 7:76050049-76050071 CAACAGAGTGGGACTCTGTCAGG - Intronic
1027222192 7:76221075-76221097 CAACAAAGTGAGACCTTGTCTGG - Intronic
1027271799 7:76525083-76525105 AGACAGAGTAAGACCCTGTCTGG + Intergenic
1027321605 7:77016224-77016246 AGACAGAGTAAGACCCTGTCTGG + Intergenic
1027325240 7:77044147-77044169 AGACAGAGTAAGACCCTGTCTGG + Intergenic
1027800456 7:82743730-82743752 CAACAGAACAAGACTCTGTCTGG + Intergenic
1028038705 7:86019616-86019638 AGACAGAGTGAGACTCTGTCTGG + Intergenic
1028397619 7:90389405-90389427 CAAGAGAGCGAGACTCCGTCTGG - Exonic
1028545363 7:91993206-91993228 CAACAGAGCAAGACCCTGTATGG - Intronic
1028592334 7:92511157-92511179 CAGCAGAGTGAGACCCTGTTGGG - Intronic
1028716575 7:93978089-93978111 CAACAGAGTGACACCCTGTCTGG - Intronic
1029030498 7:97461530-97461552 CAACGGAGTGAGACTCTGTCTGG + Intergenic
1029134752 7:98361335-98361357 CGACAGAGCAAGACTCTGTCTGG + Intronic
1029398842 7:100328445-100328467 AGACAGAGTAAGACCCTGTCTGG - Intergenic
1029717474 7:102339497-102339519 AGACAGAGTAAGACCCTGTCTGG + Intergenic
1029733648 7:102453746-102453768 CGACAGAGTGAGACTCTATCTGG - Exonic
1029802541 7:102964420-102964442 CAACAGAGAGAGACTCAGTCTGG - Intronic
1030048806 7:105520850-105520872 CAACACAGCGAGACCCTGTGTGG + Intronic
1030652169 7:112128007-112128029 CAACAGAGCGAGACTCTGTCGGG + Intronic
1032164433 7:129534279-129534301 CGACAGAGCGAGACTCCGTCTGG - Intergenic
1032248509 7:130233024-130233046 CAACAGAGTGAGACTCCATCTGG - Intergenic
1033114804 7:138615773-138615795 CGACAGAGTGAGACTCCGTCTGG + Intronic
1033138622 7:138805373-138805395 CAACAAAGTGAGACCCTGTCTGG + Exonic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033507942 7:142024392-142024414 CGACAGAGTGAGACCCTGTCTGG + Intronic
1033541146 7:142357247-142357269 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1033825765 7:145187131-145187153 TGACAGAGGGAGACCCTGGAAGG - Intergenic
1033989199 7:147263339-147263361 TGACAGAGGGAGACCCTGCCTGG + Intronic
1034079714 7:148265291-148265313 TGACAGAGTGAGACCCTGTCTGG - Intronic
1034086748 7:148328954-148328976 CGACAGAGCAAGACTCTGTCTGG + Intronic
1034105831 7:148488984-148489006 CAACAGAGAGAGACCCTGTCTGG - Intergenic
1034192554 7:149223426-149223448 AGACAGAGCCAGACCCTGTCTGG + Intronic
1034333731 7:150306659-150306681 CAACACAGCGAGACCCGGTTTGG + Intronic
1034482529 7:151333595-151333617 CAACAGAGTGAGACCTTGTCCGG + Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035005983 7:155661425-155661447 CCACAGAGCAAGACTCTGTCTGG - Intronic
1035189583 7:157153975-157153997 TGACAGAGCGAGGCCCTGTCTGG + Intronic
1035772412 8:2158389-2158411 CAACAGAGCGAGAATCTGTCAGG - Intronic
1036369797 8:8153240-8153262 TGACAGAGTGAGACCCTGTATGG - Intergenic
1036404884 8:8445906-8445928 CGACAGAGTGAGACCCTGTCTGG + Intergenic
1036881094 8:12512404-12512426 TGACAGAGTGAGACCCTGTATGG + Intergenic
1037174645 8:15932598-15932620 CAACAAAGTGAGACTCTGTCTGG - Intergenic
1037317119 8:17609453-17609475 CGACAGAGCGAGACTCTGTCTGG + Intronic
1037847322 8:22295057-22295079 CAACAGAGCGAGACTTCGTCTGG + Intronic
1037856750 8:22376856-22376878 CAACAGAGTGAGACAATGTCTGG + Intronic
1037942236 8:22960336-22960358 CAACAGAGCAAGACTCTGTCAGG - Intronic
1038095105 8:24300434-24300456 CGACAGAGCGAGACTCTGTCTGG - Intronic
1038136288 8:24789928-24789950 CAACAGAGTGAGACTCTGACTGG - Intergenic
1038281216 8:26166806-26166828 TAACAGAGTGAGACCCTGTCTGG + Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038631693 8:29251129-29251151 CAACGAGGGGAGACCCTGTCTGG + Intronic
1038659390 8:29483583-29483605 CCAAAGAGCAAGACCCTGTCTGG + Intergenic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039231533 8:35454104-35454126 CAAAAGAGGGAAAGTCTGTCAGG - Intronic
1039250714 8:35661076-35661098 TGACAGAGTGAGACCCTATCAGG + Intronic
1039449939 8:37664693-37664715 CAGCAGAGTGAAACCCTGTCTGG - Intergenic
1039991909 8:42495767-42495789 CAACAGAACAAGACTCTGTCTGG - Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040073199 8:43204836-43204858 CAACAAAAGAAGACCCCGTCTGG - Intergenic
1040798203 8:51311325-51311347 CAACATGGTGAAACCCTGTCTGG - Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041075713 8:54167751-54167773 CAACAGAGCTAGACTCTCTCTGG + Intergenic
1041174181 8:55177054-55177076 TAACAGAGCAAGACTCTGTCTGG - Intronic
1041196552 8:55407268-55407290 GAACAGAGGAAGAACATGTCGGG + Intronic
1041646940 8:60262662-60262684 CAACATAGTGAGACCCTTTCAGG + Intronic
1042110361 8:65375167-65375189 CAACATAGCAAGACCCTGTGTGG + Intergenic
1042143566 8:65704024-65704046 CAACATAGGGAAACCCTATCTGG + Intronic
1042557393 8:70044803-70044825 CAACAGAGCCAGACTCCGTCTGG - Intergenic
1042562594 8:70084209-70084231 AGACAGAGTGAGACTCTGTCTGG - Intergenic
1042813516 8:72852238-72852260 TGACAGAGAGAGACCCTGCCTGG + Intronic
1043110567 8:76175087-76175109 CAACAGAGCGAGACTCTTTCTGG - Intergenic
1043413453 8:80024207-80024229 CAACAGAGCAAGACCCTGTCTGG + Intronic
1043653832 8:82635671-82635693 TGACAGAGGGAGACTCTGTCTGG + Intergenic
1043673916 8:82925369-82925391 CGACAGAGAGAGACTCAGTCTGG - Intergenic
1044241062 8:89889041-89889063 CAACAAAGTGAGACCCTGTGTGG + Intergenic
1044434921 8:92150806-92150828 CAACAGAGTAAGACTCTGTCTGG + Intergenic
1044741182 8:95327992-95328014 CAACATAGGGAAATCCTGCCTGG - Intergenic
1044761388 8:95521204-95521226 TGACAGAGCAAGACCCTGTCTGG - Intergenic
1044778622 8:95720840-95720862 CAACAGAGTGAGACTCTGCCAGG - Intergenic
1044973152 8:97639317-97639339 CGACAGAGTGAGACCTTGTCTGG - Intergenic
1045085003 8:98672360-98672382 CAACAGAGAGAAACCTTGTATGG + Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045149421 8:99387235-99387257 CAACAGAGCAAGAACCTGTGTGG - Intronic
1045353130 8:101360650-101360672 TGACAGACGGAGTCCCTGTCGGG + Intergenic
1045491050 8:102669628-102669650 TGACACAGCGAGACCCTGTCTGG + Intergenic
1045764027 8:105646029-105646051 CAACAGAGTGAGACTCCATCTGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046757878 8:117990200-117990222 GAAGAGAGGGAGACCCAGTCTGG - Intronic
1046790509 8:118316768-118316790 GGACAGAGCGAGACCCTGTGGGG - Intronic
1047281048 8:123446011-123446033 TGACAGAGTGAGACTCTGTCTGG - Intronic
1047410042 8:124617063-124617085 CAACAGATGGAAATGCTGTCTGG + Intronic
1047523888 8:125616163-125616185 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1047613011 8:126539348-126539370 TGACAGAGCAAGACCCTGTCTGG + Intergenic
1047744403 8:127833476-127833498 CGACAGAGCAAGACCCTGTCTGG - Intergenic
1048337487 8:133513877-133513899 TAACAGAGCAAGACTCTGTCTGG + Intronic
1048848047 8:138618067-138618089 CAACTGAGAGAGTGCCTGTCAGG + Intronic
1049010127 8:139881920-139881942 CATCAGAGGGAGGCCCAGGCAGG - Intronic
1049099373 8:140568262-140568284 TGACAGAGCGAGACCATGTCTGG + Intronic
1049677328 8:143896909-143896931 CAACAGAACAAGACCCTGTCTGG - Intergenic
1049806113 8:144540776-144540798 CAATACAGTGAGAACCTGTCTGG + Intronic
1049824243 8:144657438-144657460 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1050601851 9:7260894-7260916 CAACAGAGGAAGACCCTCTTTGG - Intergenic
1051650941 9:19323408-19323430 CGACAGAGCTAGACTCTGTCTGG + Intronic
1051748757 9:20319773-20319795 CCACAGAGGGAGTGCCTGTCTGG - Intergenic
1051755019 9:20389757-20389779 CAACACAGTGAGACCCCGTCCGG + Intronic
1051936529 9:22448126-22448148 CAACAGAGTGAGATCCTGTCTGG - Intronic
1053003131 9:34588843-34588865 CAACACAGGGACACCCAGACTGG + Intronic
1053039846 9:34861154-34861176 TAACAGAATGAGACCCTGTAAGG + Intergenic
1053505746 9:38641946-38641968 CGACAGAGTGAGACCTAGTCTGG - Intergenic
1054725643 9:68647383-68647405 CAACATGGTGAAACCCTGTCTGG - Intergenic
1054786746 9:69217520-69217542 CAACCTAGTGAGACCCTGTTGGG + Intronic
1054913916 9:70478770-70478792 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1054924397 9:70574959-70574981 TGACAGAGTGAGACCCTGTTGGG - Intronic
1055191232 9:73527409-73527431 CAACAGAGTGAGACCCTGTCTGG - Intergenic
1055214398 9:73840820-73840842 CGACAGAACGAGACTCTGTCTGG + Intergenic
1056165018 9:83932604-83932626 CAACAGAAGGAGACTCTGTCTGG + Intergenic
1056256996 9:84809860-84809882 CAACAGAGCAATACTCTGTCTGG + Intronic
1056394607 9:86170094-86170116 CGACAGAGTGAGACTCTGCCTGG - Intergenic
1056400839 9:86225668-86225690 CAACATGGTGAAACCCTGTCTGG - Intronic
1056537393 9:87541527-87541549 CAACAGAGCAAGACTCTGTCTGG + Intronic
1056637224 9:88341343-88341365 CAACAGAGTGAGACTCTGTCTGG - Intergenic
1056987991 9:91382341-91382363 CAACAGAGCGAGACTCCGTCTGG + Intergenic
1057050561 9:91920484-91920506 TAACAGAACCAGACCCTGTCTGG + Intronic
1057308510 9:93926575-93926597 CAACAGAGCAAGACCCTGTCTGG + Intergenic
1057465986 9:95315243-95315265 CAGCAGACTGAGACCGTGTCTGG - Intronic
1057620465 9:96630111-96630133 CCACAGAGTGAGACTCTATCGGG + Intergenic
1057684939 9:97222708-97222730 CAGCAGAGGAAGACCGGGTCAGG - Intergenic
1058458057 9:105156530-105156552 CAACAGAGTGAGACTCCATCTGG + Intergenic
1058759979 9:108121056-108121078 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1058817528 9:108698894-108698916 CAACAGAGCAAGACCCAGTTAGG + Intergenic
1058891681 9:109366456-109366478 CAACAGAGCCAGACCCTGTCTGG - Intergenic
1059079612 9:111234183-111234205 CAACAGAGTGAGACCCTATCAGG + Intergenic
1059132987 9:111774316-111774338 TGACAGAGTGAGACCCTGTCTGG - Intronic
1059262112 9:112987733-112987755 TAACAGAGCAAGACTCTGTCTGG - Intergenic
1060291249 9:122304960-122304982 TAACAAAGCAAGACCCTGTCTGG - Intronic
1060470503 9:123944107-123944129 CAACAGAGCAAGACTGTGTCAGG + Intergenic
1060648282 9:125301466-125301488 CAACAAAGCAAGACTCTGTCTGG - Intronic
1060775431 9:126370400-126370422 CAACAGAACGAGACTCTGTCTGG - Intronic
1061334568 9:129923556-129923578 TGACAGAGCGAGACTCTGTCTGG + Intronic
1061556414 9:131372736-131372758 CGACAGAGCGAGACTCCGTCTGG - Intergenic
1061568922 9:131463959-131463981 CAACAGAGCGAGACTCCATCTGG - Intronic
1061660082 9:132124265-132124287 TAACAGAGTGAGATCCTGTCTGG + Intergenic
1062002359 9:134222846-134222868 TGACAGAGTGAGACCCTGTCAGG - Intergenic
1062593490 9:137286419-137286441 CAACCGAGTGAAACTCTGTCTGG - Intergenic
1062664578 9:137662215-137662237 TGACAGAGTGAAACCCTGTCTGG - Intronic
1062719476 9:138029628-138029650 CGACAGAGCGAGACCCTGTCTGG - Intronic
1185602363 X:1349025-1349047 CAACAGAGCAAGACCGTGTCAGG - Intronic
1185713632 X:2324035-2324057 TAACAGATGGAGACCCTGTCTGG + Intronic
1185767703 X:2739066-2739088 CAACATAGTGAGACCCTGTCTGG - Intronic
1186512471 X:10140258-10140280 TGACAGAGTGAGACCCTGTCTGG - Intronic
1186829384 X:13375707-13375729 CAACAGAGCGGGACCCTGTCTGG - Intergenic
1187134528 X:16534322-16534344 CAACAGAGCGAGACTCCGTCTGG - Intergenic
1187315246 X:18186945-18186967 CAACAGAGCAAGACCCTGTCTGG + Intronic
1187390219 X:18881388-18881410 CGACAGAGTGAGACTCTGTCTGG + Intergenic
1187468493 X:19547133-19547155 CAAAAGAGTGGGACCCTGTCTGG + Intronic
1187717128 X:22113967-22113989 CAATAGAGTGAGACTCTGTCTGG - Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188721412 X:33527955-33527977 ACACAGAGAGAGACTCTGTCTGG - Intergenic
1189307527 X:39998006-39998028 CGACAGAAGTAGACCCTGTCTGG + Intergenic
1189341345 X:40206864-40206886 CGACAGAGTGAGACGCCGTCTGG + Intergenic
1189365553 X:40385196-40385218 AAACAGTGGGAGACTCTTTCTGG + Intergenic
1189464782 X:41270088-41270110 CGACAGAGTGAGACCCTGTCCGG - Intergenic
1189828394 X:44944330-44944352 CAACAGAGTGAAACTCTGTTAGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190016923 X:46835456-46835478 CAACACAGTGAAACCCCGTCTGG - Intergenic
1190230794 X:48580414-48580436 AGACAGAGTGAGACCCTGTCTGG - Intergenic
1190341651 X:49301609-49301631 CAACAGAGTGAGACTCTGTCTGG - Intergenic
1190642521 X:52494667-52494689 CAACAGAGTGACACTCTGTCTGG + Intergenic
1190645152 X:52518200-52518222 CAACAGAGTGACACTCTGTCTGG - Intronic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1190890587 X:54563764-54563786 CAACAGAGTGAGACTGTCTCAGG + Intergenic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1192088588 X:68128067-68128089 TGACAGAGTGAGACCCTTTCTGG - Intronic
1192302334 X:69918174-69918196 TGACAGAGGAAGACTCTGTCTGG - Intronic
1192331176 X:70176487-70176509 CGACACAGTGAGACTCTGTCTGG + Intergenic
1192467872 X:71370364-71370386 TGACAGAGAGAGACTCTGTCAGG - Intronic
1192790105 X:74373194-74373216 CCACAGAGCGAGACCCTGGCTGG + Intergenic
1194323981 X:92487957-92487979 CAACAGAGTGAGACGCCATCTGG - Intronic
1194715989 X:97287283-97287305 CAACAGAGTGAAACTCCGTCGGG + Intronic
1195007801 X:100703344-100703366 CAACAAAGCAAGATCCTGTCTGG + Intronic
1195511167 X:105716978-105717000 GAACATAGGGAGACCCTGTGTGG + Intronic
1195865809 X:109431677-109431699 CGACAGAGCTAGACTCTGTCTGG + Intronic
1196369308 X:114957878-114957900 CAACAGAGAAAGACCCTGACTGG + Intergenic
1196421589 X:115527750-115527772 CAACAGAGCAAGACCATGTCTGG + Intergenic
1197555017 X:127942259-127942281 CAACACAGCAAGACCCTGTCTGG + Intergenic
1197697496 X:129566296-129566318 TAAAAGAGGGAGGCCCTGTGAGG + Intronic
1197731229 X:129812101-129812123 CAACAGAATGAGACTCTGTCTGG - Intronic
1197930282 X:131687698-131687720 CAACAGAGCGAGACTCCATCCGG - Intergenic
1198248155 X:134851514-134851536 CAACAGAGTAAGACTCTGTCTGG + Intronic
1198258160 X:134943219-134943241 CGACAGAGCGAGACTCCGTCTGG + Intergenic
1198329966 X:135613279-135613301 CATCAGAGGGATATCCTGTGGGG + Intergenic
1198375174 X:136031637-136031659 CAACAGAGCGAGACTCTGTCTGG + Intronic
1199046552 X:143181178-143181200 CAACAGAGCAAGACCCCATCAGG + Intergenic
1199295928 X:146158497-146158519 CAACAGAGCGAGACTCCATCTGG + Intergenic
1199313902 X:146354489-146354511 AACCAGAGGGAGATCCTGTAAGG + Intergenic
1200052571 X:153442813-153442835 AAACAGAAGCAGGCCCTGTCTGG + Intergenic
1200095279 X:153656510-153656532 TGACTGAGTGAGACCCTGTCTGG + Intergenic
1200130017 X:153836715-153836737 TGACAAAGCGAGACCCTGTCTGG + Intergenic
1200772655 Y:7141339-7141361 CAAGAGATCCAGACCCTGTCTGG - Intergenic
1201325596 Y:12754244-12754266 GAACAGATTGAGGCCCTGTCTGG - Intronic
1201342207 Y:12946923-12946945 CAACAGAGTGAGACTCCATCTGG - Intergenic
1201553703 Y:15246250-15246272 GAACAAAGGGAGACCATGTATGG - Intergenic
1201564818 Y:15354866-15354888 CAATAGAGCGAGACTCTGCCCGG + Intergenic