ID: 1165384144

View in Genome Browser
Species Human (GRCh38)
Location 19:35500633-35500655
Sequence AAACTGGGGCTCTGAAAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 323}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165384144_1165384157 20 Left 1165384144 19:35500633-35500655 CCGGGCTTTCAGAGCCCCAGTTT 0: 1
1: 0
2: 1
3: 30
4: 323
Right 1165384157 19:35500676-35500698 CCACGTGCTACCTATAGAGAAGG 0: 1
1: 0
2: 1
3: 4
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165384144 Original CRISPR AAACTGGGGCTCTGAAAGCC CGG (reversed) Intronic
900224980 1:1528795-1528817 AAACTGAGGCCCGGAAAGCTGGG - Intronic
900319289 1:2074610-2074632 AAACGGGGGCTCAGACAGGCGGG - Intronic
900417179 1:2540574-2540596 AAACTGAGGCCCGGAAAGCTGGG - Intergenic
901419845 1:9143472-9143494 TTCCTGTGGCTCTGAAAGCCAGG + Intergenic
901766097 1:11501142-11501164 AAGCTGGGGGTCGGGAAGCCAGG - Exonic
901903172 1:12384468-12384490 TAACTATGGCTCTGAAACCCAGG + Intronic
902536478 1:17121790-17121812 AAAATGGGGCTCCGAATGGCAGG - Intergenic
902541415 1:17158122-17158144 AAACTAAGGCTCAGAGAGCCTGG - Intergenic
903118063 1:21194595-21194617 AAACTGCAGCTCTGAAGGCTGGG + Intergenic
903733647 1:25516427-25516449 AAACTGAGGCTCAGAGAGGCAGG + Intergenic
903855951 1:26337634-26337656 CAGCTGCGGCCCTGAAAGCCTGG + Exonic
904830734 1:33305045-33305067 AAACTGGGGCCCTGAGAGACTGG - Intergenic
904970540 1:34416155-34416177 AAACTGAGGCCCTGAAGGGCTGG + Intergenic
905171778 1:36113977-36113999 AACCTGGGGCTCTGGAACTCGGG + Intronic
905903419 1:41597346-41597368 AATCTGGGCCTCTGCAAGTCTGG - Intronic
906697904 1:47837134-47837156 GCACTGGGGCTCAGGAAGCCAGG + Intronic
907130162 1:52090208-52090230 AAACTGAGGCTCAGAGAGCAAGG - Exonic
907294764 1:53443481-53443503 AAAAAGGGGTTCTGAAATCCAGG - Intergenic
907301111 1:53486822-53486844 AAACTGGGGCTGGGAGAGCCTGG + Intergenic
908310379 1:62875370-62875392 AAAATTGGGGTCTGAAGGCCAGG - Intergenic
908984571 1:70001551-70001573 AACTTGGGGCAATGAAAGCCTGG + Intronic
909341749 1:74539969-74539991 AAACTGAGGCTCAGAAAGGATGG + Intronic
911886900 1:103313281-103313303 AAACTGAGGCTCAGAAAGAGGGG + Intergenic
912419224 1:109532115-109532137 AAGCTGGGGCTCCGAAAAGCCGG + Intergenic
913168490 1:116211182-116211204 AAACTGAGGCTCAGCAAACCTGG + Intergenic
913278505 1:117162718-117162740 AAAGTGGGGCTGTTAAAGCAGGG + Intronic
914340122 1:146753160-146753182 AAACTGGTGCCCTAAAAGCAGGG + Intergenic
914770639 1:150681548-150681570 GAAGTGGGGCTTAGAAAGCCAGG + Intronic
915009457 1:152671717-152671739 AAACTGGGGCTTCAAAACCCAGG - Intergenic
918106904 1:181423388-181423410 AAGCTGGGGTCCTGAGAGCCTGG + Intronic
918318248 1:183341023-183341045 AAACTGAAGTTCTGACAGCCTGG + Intronic
918925606 1:190782101-190782123 AAGCAGGTGCTCTGAATGCCTGG - Intergenic
919848669 1:201657721-201657743 AAACTGAGGCACTGAAATACAGG + Intronic
920873240 1:209811640-209811662 AAACTGAGGCTCAGACTGCCTGG - Intergenic
921440638 1:215182172-215182194 AAACAGATGCTCTGAATGCCTGG + Intronic
921921918 1:220679316-220679338 AGGCTGGGATTCTGAAAGCCAGG - Intergenic
923546882 1:234929687-234929709 AGACTGGGGGTCTGAAATCAGGG - Intergenic
924531140 1:244894971-244894993 GAACTGGGGCCCTGAAGTCCAGG - Intergenic
924925943 1:248680688-248680710 AAACTGAGGCACTAAAACCCAGG + Intergenic
1062848042 10:722961-722983 AAACTAGGGCACTGGAAACCAGG + Intergenic
1064686564 10:17867786-17867808 AAACTTGGGCTCTAAGAGCATGG - Intronic
1065126138 10:22576261-22576283 TAACTGGGTCTGTGAATGCCTGG + Intronic
1066430693 10:35348643-35348665 ATAGCAGGGCTCTGAAAGCCCGG + Intronic
1070305493 10:75236544-75236566 AAACTGAGGCTCAGAGAGACTGG - Intergenic
1070536469 10:77381844-77381866 CAAGTGGGGCTCTGAGAGCAAGG + Intronic
1070833423 10:79433783-79433805 AAACAGGGCCTCTGAAAGGAAGG + Intronic
1071275381 10:84049386-84049408 GAAATGTGGCTCTGAAAGGCAGG + Intergenic
1074283082 10:112071489-112071511 AAACTGGAGCTCTGCCAGCATGG + Intergenic
1074826960 10:117221556-117221578 CACCTGGCTCTCTGAAAGCCAGG + Intergenic
1075580352 10:123613013-123613035 AAACTTGGGCTTTCAAAGCTTGG + Intergenic
1077416889 11:2428165-2428187 AAACAGGGACTCTAATAGCCTGG + Intergenic
1078490451 11:11763133-11763155 AAACTGAGGCTCAGAGAGGCTGG + Intergenic
1079805144 11:24921552-24921574 AAAATGCGGCTTTAAAAGCCAGG - Intronic
1080812409 11:35717678-35717700 AAACTGTGCCTCTGAGAACCAGG + Intronic
1081843249 11:46218936-46218958 AAAGTTGGGCTCTGCAGGCCGGG + Intergenic
1083284728 11:61651111-61651133 AAACTGAGTCTCAGAGAGCCTGG - Intergenic
1083305883 11:61761767-61761789 AAACTGAGGCTCAGAAAGGATGG - Intronic
1083667512 11:64284055-64284077 AAACTGGGGCTCTGAGAGTTTGG + Intronic
1084317674 11:68354764-68354786 AAACTGAGGCCCCGAAAGGCTGG - Intronic
1084520889 11:69662107-69662129 AGACTTGGGCTCTCAAAGCCTGG + Intronic
1084594494 11:70108902-70108924 AAACTGGTACCCAGAAAGCCTGG - Intronic
1085448533 11:76617005-76617027 AAACTGAGGCTCAGAGAGGCTGG + Intergenic
1085525868 11:77163224-77163246 AAACAGAGGCTCTGCAAGCATGG + Intronic
1085772666 11:79339052-79339074 AAGCTGGGGCTCTGAGTGCCAGG + Intronic
1087356223 11:97097885-97097907 AAGCAGGTGCTCTGAATGCCTGG - Intergenic
1087954206 11:104264763-104264785 AAAATGAGACTCTGAGAGCCTGG - Intergenic
1089061680 11:115630968-115630990 AAACTGAGGCTCAGAAAGACTGG + Intergenic
1089730187 11:120514380-120514402 AAACTGAGGCTCAGAGAGGCTGG + Intronic
1089783134 11:120888338-120888360 AAACTGAGGCTCTGAGAGGTTGG - Intronic
1090568481 11:128021613-128021635 GTACTGGGGCTGTGAAAGGCTGG + Intergenic
1090630011 11:128637684-128637706 AAGCAGGTGCTCTGAATGCCTGG - Intergenic
1090829296 11:130409823-130409845 AAACTGTGCATCTGAATGCCTGG + Intronic
1091171056 11:133520136-133520158 AAACTGGGTCTCTGGAGGACAGG - Intronic
1091539234 12:1444142-1444164 AAACTGCTCATCTGAAAGCCTGG - Intronic
1091723037 12:2827124-2827146 GAACGGGGGCTCTTGAAGCCAGG - Exonic
1092785058 12:12019022-12019044 GAACTGAGGCTCAGAGAGCCTGG + Intergenic
1093129586 12:15374197-15374219 AAACTGGGTCACTGAAATACTGG + Intronic
1093134753 12:15437263-15437285 AAGCAGGCGCTCTGAATGCCTGG - Intronic
1093809323 12:23472895-23472917 GATCTGGTGCTCTGAATGCCTGG - Intergenic
1094649663 12:32363011-32363033 AGACAGGGTCTCTTAAAGCCTGG - Intronic
1097145658 12:56937703-56937725 CAACTGGGGCTCTCCAAGGCTGG - Intergenic
1098371796 12:69767962-69767984 AAACAGGTGCTTTGAATGCCTGG + Intronic
1099743322 12:86669356-86669378 AAACAGGTGCTCTGAATGCCTGG - Intronic
1100664693 12:96738348-96738370 AAACTGGGTGGCTGAAAGCAAGG + Intronic
1102657167 12:114491802-114491824 AAACTGAGGCTCAGAAAGAAGGG + Intergenic
1103145102 12:118588839-118588861 AAACTGGAGGTCAGAAAACCTGG + Intergenic
1103486530 12:121286747-121286769 AAACTGAGGCACAGAGAGCCTGG + Intronic
1105436134 13:20379933-20379955 AAGCTGAGGCTCTGCAAGACTGG - Intergenic
1107172368 13:37358146-37358168 AAACTGAGAGTCTGAAAGCCAGG + Intergenic
1116254858 14:42539308-42539330 AAACTGGCTATCTGCAAGCCAGG - Intergenic
1116628487 14:47298131-47298153 AAACTGAGGCACAGAAAGCTGGG + Intronic
1116965227 14:51007587-51007609 AAACTGGGGCACAGGAAGACTGG - Intronic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1119690644 14:76669381-76669403 AAACTGAGGCTTAGAAAACCAGG - Intergenic
1121542757 14:94741012-94741034 AAACTGTGGCTCTGAGACCTTGG - Intergenic
1121626610 14:95389819-95389841 GAATTGGGTCTCTGGAAGCCTGG + Intergenic
1123176142 14:106421053-106421075 AAGGTGGGCCTCTGCAAGCCAGG - Intergenic
1202947543 14_KI270726v1_random:42510-42532 AAGGTGGGCCTCTGCAAGCCAGG + Intergenic
1125754819 15:42056423-42056445 AAACTAAGGCTCAGAAAGACTGG - Intergenic
1126789978 15:52212161-52212183 ACAATGGGGGTCTGAAATCCAGG - Intronic
1128329330 15:66745412-66745434 AAAGTGGGGCCCAGGAAGCCAGG - Intronic
1130531789 15:84752593-84752615 AAGTTGGGGCTGTGAAAGGCAGG + Intronic
1132332307 15:101021252-101021274 CAACTGGGACACAGAAAGCCAGG + Intronic
1133465268 16:6021243-6021265 AAACTTGGGCTGTCAAGGCCAGG - Intronic
1135115343 16:19718639-19718661 AAACTGAGGCTCGGAGAGGCTGG + Intronic
1136142142 16:28294394-28294416 AAACTGAGGCTCGGGAAGGCAGG + Intronic
1136644298 16:31596454-31596476 ACAGTGATGCTCTGAAAGCCAGG - Intergenic
1136660824 16:31760119-31760141 ACAGTGATGCTCTGAAAGCCAGG + Exonic
1138280429 16:55768717-55768739 AAACAGGGGCTCTGGGAACCTGG + Intergenic
1138810178 16:60139998-60140020 AAAAAGGCGCTCTGAATGCCTGG + Intergenic
1139916688 16:70432755-70432777 AAACTCGGTCTCAGAAAGCAGGG + Intronic
1139994166 16:70964248-70964270 AAACTGGTGCCCTAAAAGCAGGG - Intronic
1141169049 16:81679833-81679855 AAACTGGGGCTCCCAGAACCAGG - Intronic
1142114691 16:88350493-88350515 AAACTGAGGCTCTGAGAGGGAGG - Intergenic
1143618620 17:8068369-8068391 CAACTGGGGCTCTGGATGACTGG + Intergenic
1143785668 17:9253750-9253772 ACACTGAGGCTCTGATGGCCTGG + Intronic
1144006714 17:11106946-11106968 AAAGTGGGGGTGTGAGAGCCAGG - Intergenic
1144345941 17:14349749-14349771 AACCTGTGGCACTGAAAGACCGG - Intergenic
1145259236 17:21344950-21344972 AAACTGAGGCACGGAAAGGCTGG + Intergenic
1145317382 17:21742997-21743019 AAACTGAGGCACAGAAAGGCTGG - Intergenic
1145769328 17:27481301-27481323 AAACTGGGGCTCAGGACGCTGGG - Intronic
1145790681 17:27624814-27624836 AGACTGGGGCTCTGCTAGGCAGG - Exonic
1147384527 17:40073411-40073433 AAACTGAGTCTCAGAAAGCTTGG - Intronic
1149119190 17:53140675-53140697 TAACTGGTGCTATGAAAGCATGG + Intergenic
1149867551 17:60159103-60159125 AAAGAGGGGCTCTGAACCCCTGG - Intronic
1150222732 17:63506437-63506459 TATCTGGGTCTCTGGAAGCCAGG - Intronic
1152869428 17:82744075-82744097 GAGCTGGGGATCTGACAGCCAGG + Intronic
1153595563 18:6721614-6721636 TAACTGGGTCTCTGCAAGCGGGG - Intergenic
1155186151 18:23388406-23388428 AAAATGGGGCTGAGAAAGACTGG + Intronic
1156503318 18:37573678-37573700 AAATTGAGGCTCTGAGAGCATGG - Intergenic
1156845977 18:41665608-41665630 AATCTGGGTCTCTCAGAGCCAGG - Intergenic
1158642149 18:59213034-59213056 AATCTGCGGGTCTGAAAACCTGG + Intergenic
1159021566 18:63147214-63147236 CAAATGAGGCTCTCAAAGCCTGG - Intronic
1160921296 19:1522025-1522047 AAACTGAGGCTCCGAACGTCCGG - Intergenic
1161231778 19:3178247-3178269 AAACTGAGGCCCAGAGAGCCCGG - Intronic
1161845372 19:6709128-6709150 CAACTGGGGCCCTGAGAGGCTGG - Intronic
1162208206 19:9071758-9071780 AAACTGGGGCTCAGAGAACCAGG + Intergenic
1163091989 19:15026650-15026672 AAACTGGGGCGGTGACAGCAAGG - Intergenic
1163344853 19:16734207-16734229 AAACTGTTGCTTTGAAAGCAAGG - Intronic
1163356383 19:16814246-16814268 AAACTGAGGCTCTGAGAGGCTGG + Intronic
1163385102 19:16995100-16995122 AAGCTGGGGCCCTCAAAGCCAGG + Intronic
1163661982 19:18583709-18583731 TCACTGTGGCTCTGAAAGCCGGG - Intronic
1165384144 19:35500633-35500655 AAACTGGGGCTCTGAAAGCCCGG - Intronic
1165488020 19:36107109-36107131 CATCTTGGGCCCTGAAAGCCAGG - Intergenic
1166275131 19:41748216-41748238 AGCCTGGAGCTCTGCAAGCCAGG - Intronic
1167604542 19:50474942-50474964 AAACTGAGGCTCAGAGAGCCGGG - Intronic
1167752853 19:51390976-51390998 GAACTGGGGATCTGAACTCCCGG - Intergenic
1167940571 19:52942756-52942778 AAATTGAGGCTCTGGGAGCCAGG - Intronic
1167994976 19:53394974-53394996 AAACTGAGGCCCTGGGAGCCAGG + Intronic
926321974 2:11754807-11754829 AAATTGGGGGTCGGAAGGCCTGG - Intronic
926694929 2:15764570-15764592 AAACTGAGGCCCAGAAAGCTGGG - Intergenic
926701754 2:15808543-15808565 AACCTGGGGATCGGAACGCCAGG + Intergenic
926704133 2:15824795-15824817 AAACTGAGGCTCAGAGAGACTGG - Intergenic
926753007 2:16213802-16213824 AAACTTTTGCTCTGCAAGCCAGG - Intergenic
926766970 2:16330411-16330433 ACACTGGGGCCGAGAAAGCCCGG + Intergenic
927477007 2:23421079-23421101 AAGCTGAGGCTCAGAAAGGCAGG + Intronic
928359482 2:30651507-30651529 CAGCCGGGGCTCTGAAAGACAGG + Intergenic
928643785 2:33329096-33329118 AAACTGGTACTCTGAAAAACTGG - Intronic
929180637 2:39034740-39034762 AAACTTGAGCTATGAAAGTCAGG + Intronic
930252295 2:49048309-49048331 AACCTGGGGCTCTGAAAAGTTGG + Intronic
930864857 2:56112335-56112357 AAACAGTGGTTCTTAAAGCCTGG + Intergenic
930934640 2:56933050-56933072 AAACTGGAGCTCTGTAAGCAAGG - Intergenic
932130042 2:69179029-69179051 AAAATATGGCTCTGAAAGCCTGG - Intronic
932141362 2:69281021-69281043 AGACTGTGCCTCTGACAGCCTGG - Intergenic
932401505 2:71483736-71483758 AAACTGAGGCTCTGAGAGATTGG + Intronic
932441338 2:71737592-71737614 AAACTGAGGCTCAGAGAGCATGG - Intergenic
933183814 2:79256773-79256795 AAACTGGGGCTTAGAGAGACTGG - Intronic
933336752 2:80968148-80968170 AAACAGGTGCTCTGAATGCCTGG - Intergenic
934651967 2:96098009-96098031 AAACGGGGGCCCTGAAAAACTGG + Intergenic
934967235 2:98732998-98733020 ACATTGGGGACCTGAAAGCCAGG + Intergenic
938770821 2:134499366-134499388 AAACTGCAGTTCTGGAAGCCGGG - Intronic
939507239 2:143060516-143060538 AAACTGGAACTCTAAAAACCAGG - Intergenic
941125637 2:161580238-161580260 ACACTGGGGGTCTGGAGGCCTGG + Intronic
941587648 2:167380226-167380248 AAGCAGGTGCTCTGAATGCCTGG + Intergenic
941635677 2:167932571-167932593 ACCCTTGGGATCTGAAAGCCAGG + Intergenic
942063371 2:172248133-172248155 AGACTGGGGATCAGGAAGCCTGG + Intergenic
942462197 2:176176007-176176029 AAGGTGGAGGTCTGAAAGCCAGG - Intergenic
943141908 2:183993341-183993363 AAGCAGGTGCTCTGAATGCCTGG + Intergenic
943805985 2:192126722-192126744 AAACTGAGGCTCAGAGAGACAGG + Intronic
945267537 2:207905686-207905708 AGTTTGGGGCTCTTAAAGCCAGG + Intronic
945931900 2:215863728-215863750 AAACTCTGGCTTTGAAAACCAGG - Intergenic
946000510 2:216478241-216478263 AAAATTGGTCTCAGAAAGCCCGG - Exonic
946256080 2:218443141-218443163 ACAGTGGGACTCTGAAGGCCTGG - Intronic
947187422 2:227467572-227467594 AAACTAAGGCTCTGAAAGGCTGG - Intergenic
947399334 2:229715317-229715339 AAACTGAGGCCCAGAAAGTCTGG + Intergenic
948285679 2:236783256-236783278 AAACTATGGCTCTGACAGCATGG - Intergenic
948552076 2:238779297-238779319 AAACTGGGTCTTTGAATTCCTGG + Intergenic
948999587 2:241605259-241605281 GAGCTGGGGGTCTGAGAGCCAGG + Intronic
1170443600 20:16402700-16402722 AAACTGGAGCTCAGAACACCTGG + Intronic
1171257500 20:23701226-23701248 ACACAGGTGCTCTGAATGCCTGG - Intergenic
1172120101 20:32593351-32593373 ATGCTGGGGCTCTGAATGCTTGG + Intronic
1172178597 20:32987247-32987269 AAACTGAGGCTCAAAGAGCCAGG - Intronic
1173534018 20:43795093-43795115 AAACTGAGGCCCAGAAAGTCAGG + Intergenic
1173869632 20:46333144-46333166 AAACCTGGGCCCTGCAAGCCTGG - Intergenic
1173918865 20:46729030-46729052 ACGCTTGGGCTCCGAAAGCCTGG - Intronic
1174082431 20:47979933-47979955 AAACTGAGGCTCAGAGAGGCAGG + Intergenic
1174215005 20:48909817-48909839 ATACTGGGTCTCTGAAGACCTGG - Intergenic
1174524841 20:51162699-51162721 AAACTGAGGCACAGAAAGGCTGG - Intergenic
1175037346 20:56012476-56012498 AAACAGGAGTTCAGAAAGCCAGG + Intergenic
1175903461 20:62368884-62368906 AGCTTGGGGCTCTGACAGCCTGG + Intergenic
1180949824 22:19715940-19715962 GAACTGAGGCTGGGAAAGCCAGG + Intronic
1181532221 22:23523131-23523153 ATCCTGGGACACTGAAAGCCAGG - Intergenic
1181787255 22:25236147-25236169 AAACTGAGGCTCAGAGGGCCTGG + Intergenic
1181915443 22:26276054-26276076 AAACTGGGGCTCTGAGAGAGAGG - Intronic
1182681350 22:32082435-32082457 ATACTGGGGTTTGGAAAGCCAGG + Intronic
1183057473 22:35315723-35315745 AAACTGTGGCTCTGAGACCTTGG - Intronic
1183164811 22:36139663-36139685 AAACTGAGGCTCAGAGAGGCGGG + Intergenic
1184339242 22:43876989-43877011 CAACTGGTGCTCAGAAAGCCAGG + Intergenic
1184467923 22:44679829-44679851 AGCCTGGGGCTCGGGAAGCCCGG + Exonic
1184690060 22:46113491-46113513 AAACTGAGGCCCAGAGAGCCAGG + Intronic
1184984139 22:48117974-48117996 TATCTGGGGCTCTGAATGCATGG + Intergenic
950552932 3:13677882-13677904 AAACTGGGGCTCAGAATAACTGG - Intergenic
950560625 3:13719538-13719560 AAACTGAGGCTCAGAAAGGGTGG + Intergenic
951302201 3:21011733-21011755 AAACTGTGGTTGTGAAATCCAGG - Intergenic
952218400 3:31300505-31300527 CAACAGGGGGTCTAAAAGCCTGG - Intergenic
952667289 3:35922273-35922295 AAACAGATGCTCTGAATGCCTGG + Intergenic
953151517 3:40329425-40329447 AAACTGAGGCTGTGAGAGACTGG - Intergenic
953848986 3:46450786-46450808 AAACTGAGGGTCAGAAAGGCAGG + Intronic
954485938 3:50851306-50851328 AAGCAGGTGCTCTGAATGCCTGG + Intronic
955397921 3:58570002-58570024 AAACTAAGGCTCAGAAAGTCAGG - Intronic
956770969 3:72525707-72525729 AAACTGAGGCTCTCATAGCTTGG - Intergenic
956901963 3:73726225-73726247 AAACTGGGGCTCTGTGAGGGAGG + Intergenic
957984347 3:87553324-87553346 TAACTCTGCCTCTGAAAGCCTGG - Intergenic
958052919 3:88370954-88370976 AAAGTAGCCCTCTGAAAGCCAGG + Intergenic
961390927 3:126551925-126551947 AAACTGGGGGACAGAAAGCCAGG + Intronic
962281020 3:134051967-134051989 AAACAGAGGTTCTGAAAGCATGG - Intronic
962911535 3:139855735-139855757 AAACAAGTGCTCTGAATGCCTGG + Intergenic
964024562 3:152057199-152057221 AAACTGAGGCTCTGCAAACTTGG - Intergenic
964637705 3:158875597-158875619 AAACTAGGACTCTGGAATCCTGG + Intergenic
966244141 3:177787217-177787239 AAACTGAGGCCCAGAAAGTCAGG - Intergenic
967137583 3:186525488-186525510 AAACGGGGGCTCAGAGAGGCAGG + Intergenic
969609247 4:8217911-8217933 AGCCTGGGGCTCTGGAGGCCTGG - Intronic
971389760 4:26175166-26175188 AAACTGGGGCCAAGAAAGCGTGG - Intronic
972225140 4:37003824-37003846 AAACTGGGACAGTGAAAACCAGG + Intergenic
974146032 4:57948672-57948694 AAACTGGGATTCTGGAAGACAGG - Intergenic
975496009 4:75036738-75036760 TATCTGGTGCTCTGAACGCCTGG - Intronic
975867889 4:78744135-78744157 AAACTGAGTCTTTGAAAGCAGGG + Intergenic
975943987 4:79682409-79682431 CAACTGGGGCTTTTACAGCCTGG + Intergenic
978164191 4:105587104-105587126 AATCTGGGGCACTGAGAGGCAGG + Intronic
979913778 4:126404755-126404777 AAACTGGTGCTCTGAATGCTTGG - Intergenic
980798583 4:137717775-137717797 AAGGTAGGCCTCTGAAAGCCAGG - Intergenic
980852833 4:138404004-138404026 AAACTGGGAAATTGAAAGCCAGG + Intergenic
981141424 4:141274006-141274028 AAACAGGGACTCTGAAAACAAGG - Intergenic
982843746 4:160224029-160224051 AAGCAGGTGCTCTGAATGCCTGG + Intergenic
983200264 4:164853356-164853378 GAACTGGGGATGTGAAACCCAGG + Intergenic
984222357 4:176993915-176993937 AAACTGGGGCATAGAAAGGCGGG - Intergenic
987084010 5:14452184-14452206 GAGCTGGGGCTGTGAAGGCCGGG - Intronic
987945819 5:24607124-24607146 ATATGAGGGCTCTGAAAGCCTGG + Intronic
989559599 5:42836112-42836134 AAAGTGGGACTGTGGAAGCCTGG + Intronic
990187136 5:53221215-53221237 TCACTGTGGCTCTGAAAGCCGGG + Intergenic
990200393 5:53366328-53366350 AGTCAGGGGCTTTGAAAGCCTGG + Intergenic
991210586 5:64099933-64099955 AAGCTGGGGCTCTAAAAACCTGG + Intergenic
992006266 5:72480914-72480936 ATACAGGGGCTCTTAAAGCGTGG - Intronic
992263557 5:74994545-74994567 AACCTGGGACTCGGAAAGCAGGG + Intergenic
994010499 5:94896932-94896954 AACCTGGGACTCTGGAATCCAGG + Intronic
994399689 5:99263874-99263896 AAGCAGGTGCTCTGAATGCCTGG - Intergenic
994619511 5:102146368-102146390 AAGCTGGAGATCTGAAAGCCAGG - Intergenic
996006699 5:118429659-118429681 TAACTGGTGCTCTGAAACCATGG - Intergenic
997513609 5:134469335-134469357 AATCTATGGATCTGAAAGCCAGG - Intergenic
997826629 5:137112341-137112363 AAACTGGGGCTTGGGAAGCGTGG - Intronic
997887874 5:137647759-137647781 AAAATGGGGGTCTGAGAACCAGG + Intronic
998142055 5:139705581-139705603 AAACTGTGGCTCTGCGATCCTGG - Intergenic
999009265 5:148017068-148017090 AAGCTGGGAGTCTGAAAACCTGG + Intergenic
1005091643 6:22062977-22062999 AAATAGGGGCTTTGAAAACCAGG - Intergenic
1005498929 6:26413103-26413125 ATGCTGAGGCTCTGAAATCCAGG + Intronic
1005503677 6:26451609-26451631 ATGCTGAGGCTCTGAAATCCAGG + Intronic
1006169519 6:32085143-32085165 AAAGAGGGGATGTGAAAGCCAGG + Intronic
1006180754 6:32152095-32152117 AAACTGGGGGCTTGAATGCCGGG - Intronic
1007132949 6:39493874-39493896 AAAAGAAGGCTCTGAAAGCCAGG - Intronic
1007683224 6:43648797-43648819 TAGCTGGGGCTCTGGAAGGCAGG + Intronic
1007704525 6:43782763-43782785 AGACTGGGGCTCTGAGGGCAAGG + Intronic
1007775340 6:44221848-44221870 AAACTGGGGCCCTGCCAGCTCGG - Intronic
1009787533 6:68358638-68358660 AAACAGGTGCTCTGAATGGCTGG + Intergenic
1011507403 6:88061472-88061494 AAAGTGGGGCGCGGAATGCCAGG + Intronic
1013537339 6:111075251-111075273 ATGCTGAGGCTCTGGAAGCCTGG + Intergenic
1015560593 6:134511089-134511111 AAATTGGCTGTCTGAAAGCCAGG - Intergenic
1015560781 6:134513093-134513115 AGACTGGGGCTCTGCCAGCCAGG - Intergenic
1016175615 6:141074889-141074911 AAGCAGGTGCTCTGAATGCCTGG + Intergenic
1016795936 6:148117319-148117341 AAACTGAGGCCCTGAAAGTTCGG - Intergenic
1018256943 6:161930090-161930112 ATACTGGGGTTCAGACAGCCTGG + Intronic
1018437752 6:163778165-163778187 ATACTGGGACTCTGAAGGCAAGG + Intergenic
1018628667 6:165804615-165804637 AACCTGGGGCCCTGGAAACCCGG + Intronic
1019045204 6:169140123-169140145 AACCTGGGGCTCCGGAGGCCCGG - Intergenic
1019057606 6:169234696-169234718 AAGCGGGGGCACTGAAACCCGGG - Intronic
1019703881 7:2488269-2488291 AAACTGAGGCTCAGAGAGACGGG + Intergenic
1019768997 7:2871536-2871558 ACCCTCGGGCTCTGCAAGCCTGG - Intergenic
1019809908 7:3157771-3157793 AAACGTGGGCTATGAAAGACAGG + Intronic
1019938515 7:4271569-4271591 AAAAGGGGGCTCTGGAAGCCAGG - Intergenic
1021197692 7:17691237-17691259 AAATTGAGGCTCAGAAAGTCTGG + Intergenic
1021989561 7:26128972-26128994 GATCTGGGGCTCTAAATGCCGGG - Intergenic
1022504087 7:30899866-30899888 AAACTGAGGCTCAGCCAGCCAGG + Intergenic
1022593945 7:31693517-31693539 AAACTGAGGCTCAGAAAGCCAGG - Intronic
1023351610 7:39325821-39325843 ACACTGATGCTTTGAAAGCCGGG + Intronic
1023534474 7:41193839-41193861 AAACTGTGGCACTGCAAGTCAGG + Intergenic
1023556344 7:41427033-41427055 AAAAGAGGGCTCTGAAAGCCAGG - Intergenic
1023830935 7:44038763-44038785 CAAGTGGGGCTCTGAGAGGCCGG - Intergenic
1024329331 7:48140698-48140720 TAACTGGGACTCTGAGAGCAAGG - Intergenic
1028845308 7:95473419-95473441 AACCTGTGGCTCTCACAGCCAGG - Intergenic
1029741269 7:102493072-102493094 CAAGTGGGGCTCTGAGAGGCCGG - Intronic
1029759259 7:102592241-102592263 CAAGTGGGGCTCTGAGAGGCCGG - Intronic
1029776628 7:102688151-102688173 CAAGTGGGGCTCTGAGAGGCCGG - Intergenic
1030058242 7:105601938-105601960 AAAGTGGTTCCCTGAAAGCCAGG - Intergenic
1031904631 7:127447112-127447134 AAGCAGGTGCTCTGAATGCCTGG - Intergenic
1031964775 7:128019828-128019850 AAACTGGGGTCCAGAAAGCTAGG - Intronic
1032109234 7:129061166-129061188 AAAGTGGTGATCTGCAAGCCAGG - Intergenic
1032252345 7:130269125-130269147 CAGCTGGGGTTCTGAAAACCTGG + Intronic
1033669876 7:143481627-143481649 AAACTGAGGCTCAGAGAGCAAGG + Intergenic
1034284340 7:149874321-149874343 CACCTGGGTCTCTGACAGCCGGG + Intronic
1034928394 7:155141272-155141294 ATACTGGGGCTCAGAAATGCAGG - Intergenic
1035106778 7:156447616-156447638 AACCTGAGGCTCAGAAAGACGGG - Intergenic
1035645584 8:1216290-1216312 ATACAGGGGCTCTGATATCCAGG + Intergenic
1035906479 8:3516070-3516092 AAACTGGAGCTCAGACAGCCTGG + Intronic
1039954195 8:42194918-42194940 AAACTGGGGCTCTGGGGTCCAGG - Intronic
1041292777 8:56322240-56322262 AAACTGGGTCACTGAGAGTCAGG + Intergenic
1043081699 8:75774418-75774440 CAACTGAGGCTTTCAAAGCCAGG - Intergenic
1043741989 8:83825630-83825652 AAACTGGGGCTCAGAGAGATTGG + Intergenic
1045094678 8:98785205-98785227 AAGCAGGTGCTCTGAATGCCTGG - Intronic
1046712599 8:117527694-117527716 AAACTGAGGCTTGGAAAGACTGG + Intronic
1046920176 8:119719388-119719410 AAATTGGGGTTCTGTAAGCAAGG + Intergenic
1047566199 8:126046827-126046849 AAGCTGGTACTCTGAATGCCTGG + Intergenic
1047575419 8:126148995-126149017 GAACAGGTGCTCTGAATGCCTGG - Intergenic
1047825303 8:128567100-128567122 AAACTGAGGCTCAGAAAGTTTGG - Intergenic
1047930981 8:129728136-129728158 AAGCCGGTGCTCTGAATGCCTGG - Intergenic
1048250038 8:132857756-132857778 AAAATAGGGCTTTGAAGGCCTGG + Intergenic
1048330084 8:133465299-133465321 ACACTGAGGCTCTGAGAGGCAGG + Intronic
1048458946 8:134603740-134603762 CAACTGGGCCTCTGTGAGCCTGG + Intronic
1049025189 8:139983627-139983649 AAACTGGGCCTTTGATATCCAGG - Intronic
1051752777 9:20361065-20361087 AAACTGAGACTCAGAAAGACTGG + Intronic
1052361348 9:27563634-27563656 AATATGGGGCTCTGAAAAACTGG - Intronic
1055554555 9:77461449-77461471 AAAACGGGGCTCAGAAAGCTTGG + Intronic
1057353490 9:94318404-94318426 AAAGTGGGGCTCTGAAGTCTCGG - Exonic
1057548229 9:96033886-96033908 ATACCGGGGCTCAGAAGGCCAGG + Intergenic
1057654261 9:96939188-96939210 AAAGTGGGGCTCTGAAGTCTCGG + Exonic
1058682431 9:107451888-107451910 AAAGCGTGGCTCTGAAAGGCAGG - Intergenic
1059170712 9:112122091-112122113 AAACCGAGGCTCAGAATGCCTGG + Intronic
1059509115 9:114827562-114827584 AAAATGGAGCTCTGGTAGCCAGG + Intergenic
1060314795 9:122499440-122499462 AAACAGGTGCTTTGAATGCCTGG + Intergenic
1060524344 9:124312120-124312142 AAACTGGGGTCCGGTAAGCCGGG - Intronic
1060546442 9:124464432-124464454 AAACTGAGGCTCAGAAAGGAGGG - Intronic
1060755863 9:126212885-126212907 GAACTTGGGCACTGAGAGCCCGG + Intergenic
1186521876 X:10213524-10213546 ACACTGGGCCTCTGGAACCCAGG - Intronic
1186712412 X:12213114-12213136 AAACTGAGGCTCAGAAACACAGG - Intronic
1187324141 X:18271096-18271118 CAACAGGGGGTCTGGAAGCCTGG + Intronic
1188280319 X:28260128-28260150 AATCTGGGGCTCTGACAGCTTGG + Intergenic
1190680669 X:52825452-52825474 AAACTGAGGCTCTGAAATGGAGG - Intergenic
1190685058 X:52865958-52865980 AAACTGAGGCTCTGAAATGGAGG - Intronic
1190939424 X:55026243-55026265 TAACTGGAGGTCAGAAAGCCTGG + Intronic
1191000503 X:55655861-55655883 AAACTGAGGCTCTGAAATGGAGG - Intergenic
1193026605 X:76851858-76851880 AATCTGGTGGTCTGAATGCCTGG + Intergenic
1193026637 X:76852083-76852105 AAATGGGTGCTCTGAATGCCTGG + Intergenic
1193608003 X:83592324-83592346 AAACTGAGGCTCTAAAAACATGG - Intergenic
1195304541 X:103567229-103567251 AGGCTGGGACCCTGAAAGCCAGG - Intergenic
1195415835 X:104618756-104618778 AAGCTGGTTCTCTGAATGCCTGG + Intronic
1195487601 X:105426865-105426887 AACCTTGGGCTAGGAAAGCCTGG + Intronic
1198891714 X:141403758-141403780 AACCTGGGCCTCTGGAATCCTGG - Intergenic