ID: 1165384321

View in Genome Browser
Species Human (GRCh38)
Location 19:35501680-35501702
Sequence AGCAGCTGCCTCCACTAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165384312_1165384321 10 Left 1165384312 19:35501647-35501669 CCCATCCTCCCTGACCCAGGTCT No data
Right 1165384321 19:35501680-35501702 AGCAGCTGCCTCCACTAGACAGG No data
1165384315_1165384321 2 Left 1165384315 19:35501655-35501677 CCCTGACCCAGGTCTTCAGACCC No data
Right 1165384321 19:35501680-35501702 AGCAGCTGCCTCCACTAGACAGG No data
1165384317_1165384321 -4 Left 1165384317 19:35501661-35501683 CCCAGGTCTTCAGACCCTCAGCA No data
Right 1165384321 19:35501680-35501702 AGCAGCTGCCTCCACTAGACAGG No data
1165384311_1165384321 11 Left 1165384311 19:35501646-35501668 CCCCATCCTCCCTGACCCAGGTC No data
Right 1165384321 19:35501680-35501702 AGCAGCTGCCTCCACTAGACAGG No data
1165384308_1165384321 23 Left 1165384308 19:35501634-35501656 CCCAGAGGTTCTCCCCATCCTCC No data
Right 1165384321 19:35501680-35501702 AGCAGCTGCCTCCACTAGACAGG No data
1165384314_1165384321 5 Left 1165384314 19:35501652-35501674 CCTCCCTGACCCAGGTCTTCAGA No data
Right 1165384321 19:35501680-35501702 AGCAGCTGCCTCCACTAGACAGG No data
1165384318_1165384321 -5 Left 1165384318 19:35501662-35501684 CCAGGTCTTCAGACCCTCAGCAG No data
Right 1165384321 19:35501680-35501702 AGCAGCTGCCTCCACTAGACAGG No data
1165384309_1165384321 22 Left 1165384309 19:35501635-35501657 CCAGAGGTTCTCCCCATCCTCCC No data
Right 1165384321 19:35501680-35501702 AGCAGCTGCCTCCACTAGACAGG No data
1165384307_1165384321 26 Left 1165384307 19:35501631-35501653 CCGCCCAGAGGTTCTCCCCATCC No data
Right 1165384321 19:35501680-35501702 AGCAGCTGCCTCCACTAGACAGG No data
1165384313_1165384321 9 Left 1165384313 19:35501648-35501670 CCATCCTCCCTGACCCAGGTCTT No data
Right 1165384321 19:35501680-35501702 AGCAGCTGCCTCCACTAGACAGG No data
1165384316_1165384321 1 Left 1165384316 19:35501656-35501678 CCTGACCCAGGTCTTCAGACCCT No data
Right 1165384321 19:35501680-35501702 AGCAGCTGCCTCCACTAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165384321 Original CRISPR AGCAGCTGCCTCCACTAGAC AGG Intronic