ID: 1165385170

View in Genome Browser
Species Human (GRCh38)
Location 19:35506142-35506164
Sequence AGTGGAGGAGGTGACGCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 250}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165385170_1165385178 3 Left 1165385170 19:35506142-35506164 CCAACAGCGTCACCTCCTCCACT 0: 1
1: 0
2: 4
3: 20
4: 250
Right 1165385178 19:35506168-35506190 CCAGCTCGACCCTTGCCCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 162
1165385170_1165385180 7 Left 1165385170 19:35506142-35506164 CCAACAGCGTCACCTCCTCCACT 0: 1
1: 0
2: 4
3: 20
4: 250
Right 1165385180 19:35506172-35506194 CTCGACCCTTGCCCCTGGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 100
1165385170_1165385181 8 Left 1165385170 19:35506142-35506164 CCAACAGCGTCACCTCCTCCACT 0: 1
1: 0
2: 4
3: 20
4: 250
Right 1165385181 19:35506173-35506195 TCGACCCTTGCCCCTGGGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 101
1165385170_1165385187 17 Left 1165385170 19:35506142-35506164 CCAACAGCGTCACCTCCTCCACT 0: 1
1: 0
2: 4
3: 20
4: 250
Right 1165385187 19:35506182-35506204 GCCCCTGGGTGGGGAAAAGGGGG 0: 1
1: 0
2: 2
3: 49
4: 390
1165385170_1165385176 2 Left 1165385170 19:35506142-35506164 CCAACAGCGTCACCTCCTCCACT 0: 1
1: 0
2: 4
3: 20
4: 250
Right 1165385176 19:35506167-35506189 CCCAGCTCGACCCTTGCCCCTGG 0: 1
1: 0
2: 0
3: 26
4: 252
1165385170_1165385186 16 Left 1165385170 19:35506142-35506164 CCAACAGCGTCACCTCCTCCACT 0: 1
1: 0
2: 4
3: 20
4: 250
Right 1165385186 19:35506181-35506203 TGCCCCTGGGTGGGGAAAAGGGG 0: 1
1: 0
2: 1
3: 28
4: 342
1165385170_1165385185 15 Left 1165385170 19:35506142-35506164 CCAACAGCGTCACCTCCTCCACT 0: 1
1: 0
2: 4
3: 20
4: 250
Right 1165385185 19:35506180-35506202 TTGCCCCTGGGTGGGGAAAAGGG 0: 1
1: 0
2: 1
3: 23
4: 257
1165385170_1165385184 14 Left 1165385170 19:35506142-35506164 CCAACAGCGTCACCTCCTCCACT 0: 1
1: 0
2: 4
3: 20
4: 250
Right 1165385184 19:35506179-35506201 CTTGCCCCTGGGTGGGGAAAAGG 0: 1
1: 1
2: 5
3: 29
4: 298
1165385170_1165385179 6 Left 1165385170 19:35506142-35506164 CCAACAGCGTCACCTCCTCCACT 0: 1
1: 0
2: 4
3: 20
4: 250
Right 1165385179 19:35506171-35506193 GCTCGACCCTTGCCCCTGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165385170 Original CRISPR AGTGGAGGAGGTGACGCTGT TGG (reversed) Intronic