ID: 1165385382

View in Genome Browser
Species Human (GRCh38)
Location 19:35507496-35507518
Sequence TCCCTAGGAAATAAGCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 227}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165385382_1165385385 -6 Left 1165385382 19:35507496-35507518 CCTCTTTGCTTATTTCCTAGGGA 0: 1
1: 0
2: 0
3: 32
4: 227
Right 1165385385 19:35507513-35507535 TAGGGAGACAGAAAACGGAGAGG 0: 1
1: 0
2: 2
3: 30
4: 380
1165385382_1165385396 23 Left 1165385382 19:35507496-35507518 CCTCTTTGCTTATTTCCTAGGGA 0: 1
1: 0
2: 0
3: 32
4: 227
Right 1165385396 19:35507542-35507564 TGGGGAGGCAGGCGGGCAGGGGG 0: 1
1: 5
2: 16
3: 207
4: 1595
1165385382_1165385393 20 Left 1165385382 19:35507496-35507518 CCTCTTTGCTTATTTCCTAGGGA 0: 1
1: 0
2: 0
3: 32
4: 227
Right 1165385393 19:35507539-35507561 TGATGGGGAGGCAGGCGGGCAGG 0: 1
1: 0
2: 6
3: 91
4: 746
1165385382_1165385390 12 Left 1165385382 19:35507496-35507518 CCTCTTTGCTTATTTCCTAGGGA 0: 1
1: 0
2: 0
3: 32
4: 227
Right 1165385390 19:35507531-35507553 AGAGGAGTTGATGGGGAGGCAGG 0: 1
1: 0
2: 5
3: 68
4: 690
1165385382_1165385388 5 Left 1165385382 19:35507496-35507518 CCTCTTTGCTTATTTCCTAGGGA 0: 1
1: 0
2: 0
3: 32
4: 227
Right 1165385388 19:35507524-35507546 AAAACGGAGAGGAGTTGATGGGG 0: 1
1: 0
2: 0
3: 25
4: 193
1165385382_1165385391 15 Left 1165385382 19:35507496-35507518 CCTCTTTGCTTATTTCCTAGGGA 0: 1
1: 0
2: 0
3: 32
4: 227
Right 1165385391 19:35507534-35507556 GGAGTTGATGGGGAGGCAGGCGG 0: 1
1: 0
2: 4
3: 146
4: 937
1165385382_1165385394 21 Left 1165385382 19:35507496-35507518 CCTCTTTGCTTATTTCCTAGGGA 0: 1
1: 0
2: 0
3: 32
4: 227
Right 1165385394 19:35507540-35507562 GATGGGGAGGCAGGCGGGCAGGG 0: 1
1: 0
2: 8
3: 116
4: 1006
1165385382_1165385386 3 Left 1165385382 19:35507496-35507518 CCTCTTTGCTTATTTCCTAGGGA 0: 1
1: 0
2: 0
3: 32
4: 227
Right 1165385386 19:35507522-35507544 AGAAAACGGAGAGGAGTTGATGG 0: 1
1: 0
2: 1
3: 38
4: 389
1165385382_1165385389 8 Left 1165385382 19:35507496-35507518 CCTCTTTGCTTATTTCCTAGGGA 0: 1
1: 0
2: 0
3: 32
4: 227
Right 1165385389 19:35507527-35507549 ACGGAGAGGAGTTGATGGGGAGG 0: 1
1: 0
2: 1
3: 17
4: 275
1165385382_1165385387 4 Left 1165385382 19:35507496-35507518 CCTCTTTGCTTATTTCCTAGGGA 0: 1
1: 0
2: 0
3: 32
4: 227
Right 1165385387 19:35507523-35507545 GAAAACGGAGAGGAGTTGATGGG 0: 1
1: 0
2: 0
3: 17
4: 194
1165385382_1165385395 22 Left 1165385382 19:35507496-35507518 CCTCTTTGCTTATTTCCTAGGGA 0: 1
1: 0
2: 0
3: 32
4: 227
Right 1165385395 19:35507541-35507563 ATGGGGAGGCAGGCGGGCAGGGG 0: 1
1: 0
2: 64
3: 556
4: 3114
1165385382_1165385392 16 Left 1165385382 19:35507496-35507518 CCTCTTTGCTTATTTCCTAGGGA 0: 1
1: 0
2: 0
3: 32
4: 227
Right 1165385392 19:35507535-35507557 GAGTTGATGGGGAGGCAGGCGGG 0: 2
1: 1
2: 3
3: 36
4: 538

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165385382 Original CRISPR TCCCTAGGAAATAAGCAAAG AGG (reversed) Intronic
900457022 1:2780972-2780994 TACTTAGGAATTAACCAAAGAGG - Intronic
904524780 1:31124768-31124790 TCCCTAGAAAAAAATTAAAGAGG - Intergenic
905848988 1:41258852-41258874 TGCCTAGAAAATAAACAAAGCGG - Intergenic
908330878 1:63069667-63069689 TCCCCAGGACATAAACAAGGTGG - Intergenic
911602517 1:99862249-99862271 TCCCTTAGAAATGAGAAAAGTGG + Exonic
912338833 1:108889796-108889818 ACCCTAGGTATTAAGCAGAGAGG - Intronic
914589092 1:149090413-149090435 TACATAGGAAATGAGCAAACAGG - Intronic
914935975 1:151980625-151980647 TCCCTACTAAATGAGCAATGAGG + Intergenic
915193574 1:154172376-154172398 TCCCTAGCAGATTGGCAAAGTGG + Intronic
917639435 1:176968859-176968881 TTTTTAGGAAATAAGCTAAGTGG + Intronic
918989410 1:191679058-191679080 TTCCTAGGAATTAACCAAAATGG - Intergenic
919057205 1:192586106-192586128 TCCCTAGGAAAAAGTCAAATGGG + Intergenic
920220115 1:204390891-204390913 GCACTAGGAAAGAAGCAGAGAGG + Intergenic
920424128 1:205859921-205859943 TCCCCAGGAAGTAAGGAAATGGG - Intergenic
920957772 1:210634852-210634874 TGGCAAGGAAATAAGCAATGTGG + Intronic
921847607 1:219900656-219900678 TCCCTGTCAAATAAGGAAAGTGG - Intronic
921888568 1:220330756-220330778 TCCCAAGGAAATGGGCAAAGGGG + Intergenic
924532684 1:244906654-244906676 ACCCTAGGAAATAATTATAGGGG + Intergenic
1068012582 10:51472132-51472154 TTCCTAGGATATTAGTAAAGGGG + Intronic
1068631732 10:59304972-59304994 TCCCATGGCAAAAAGCAAAGGGG - Intronic
1072238500 10:93473592-93473614 TCCCTGGGAAATGAGGAGAGGGG + Intronic
1073580429 10:104660564-104660586 TCCCTAGGTCAGAAGGAAAGTGG - Intronic
1074389756 10:113047164-113047186 TCCCAAGAAAATAATAAAAGGGG - Intronic
1075506955 10:123032377-123032399 TCCCTTAGAAATAAGAAATGTGG + Intronic
1077709065 11:4517602-4517624 TCCCTAGGTAAAAACCAAACAGG - Intergenic
1081952407 11:47055588-47055610 GCCCTAAGAAATAGGTAAAGTGG + Intronic
1082121358 11:48383372-48383394 TCCCAAGGACATAAAAAAAGAGG + Intergenic
1082201640 11:49378224-49378246 CCTCCAGGCAATAAGCAAAGAGG + Intergenic
1084210959 11:67622153-67622175 CCAGAAGGAAATAAGCAAAGAGG + Intergenic
1085462823 11:76705107-76705129 TTCCTAGCAACAAAGCAAAGAGG + Intergenic
1088437339 11:109829793-109829815 TGCTTAGGAAATAGGTAAAGAGG + Intergenic
1091063962 11:132491367-132491389 TGCCTAGAAGATAAGCAATGGGG - Intronic
1092785251 12:12020523-12020545 TCCCTAGGAAATTATCTAATAGG + Intergenic
1096930446 12:55202618-55202640 TACCTAGGAATTAACCAAATAGG + Intergenic
1098694118 12:73529781-73529803 TTCCTTGGATATAAGCAAAAAGG - Intergenic
1099676511 12:85767472-85767494 TCCCAATGAGAAAAGCAAAGCGG + Intergenic
1100135173 12:91545144-91545166 ACCCCAGGAGACAAGCAAAGTGG + Intergenic
1100286097 12:93168401-93168423 TCGCGCGGAGATAAGCAAAGTGG + Intergenic
1100664490 12:96736477-96736499 TCACTAAGAACTAAGAAAAGGGG + Intronic
1102899993 12:116628902-116628924 TCCCAAGGAAATAAACAGGGTGG - Intergenic
1104572609 12:129938316-129938338 ACCCTGGGAAGGAAGCAAAGAGG - Intergenic
1105594303 13:21821664-21821686 TCCCTATGAAATAAGGAATATGG - Intergenic
1105663289 13:22523606-22523628 TACTTAGGAATTAACCAAAGAGG + Intergenic
1106402907 13:29446603-29446625 TCCCAAGAAAATAACAAAAGAGG - Intronic
1106408982 13:29497985-29498007 GGCATAGGAAATGAGCAAAGTGG - Intronic
1107150101 13:37100974-37100996 TCCCTAGGAACTACAAAAAGAGG - Intergenic
1107168291 13:37309472-37309494 AGCCCAGGAAATAAGGAAAGTGG - Intergenic
1110360770 13:74622427-74622449 TTCCATGGAAATTAGCAAAGGGG + Intergenic
1112123573 13:96440139-96440161 TCCCTAGTATAGAAACAAAGAGG + Intronic
1113144007 13:107186664-107186686 TGCCTAGAAAATATGCAAATGGG - Intronic
1113921521 13:113915817-113915839 TCCCTAGGAAATAAACACGGAGG + Intergenic
1114688656 14:24559452-24559474 TCCCTAGGAATGAAGCAGACAGG - Intergenic
1114849545 14:26367344-26367366 TCCCTTGGAACTATGCAATGTGG - Intergenic
1115432637 14:33338254-33338276 TTCTTAGGAAGAAAGCAAAGAGG - Intronic
1116608496 14:47034664-47034686 TCCATGTGCAATAAGCAAAGTGG - Intronic
1116777118 14:49193922-49193944 TCCATAGGAAATAAGAGAAGAGG - Intergenic
1121250386 14:92495444-92495466 TTCCTAAGAAATCAGCAAAGAGG + Exonic
1121656060 14:95596513-95596535 TCCTTAGGAAATTATCAAAGAGG - Intergenic
1122401615 14:101470638-101470660 TCTGTAGGAAATCTGCAAAGTGG - Intergenic
1122643004 14:103172254-103172276 TCCCCAGGAAGTAAGGAAATGGG - Intergenic
1123111677 14:105871951-105871973 CACCTAGGAATTAACCAAAGAGG - Intergenic
1123916440 15:25033502-25033524 TCCATAGTTCATAAGCAAAGGGG + Intergenic
1124087115 15:26561174-26561196 TCCCTAGAAAAGAAACAAAGTGG + Exonic
1124223217 15:27867861-27867883 TCCTTAAAAAATAAGCAAAAAGG - Intronic
1126225164 15:46261857-46261879 CCCCCAGGAAACAAGCAAAGTGG - Intergenic
1128435702 15:67645514-67645536 ACACTAGGCAATAAGCAGAGAGG - Intronic
1132253482 15:100352420-100352442 TCCCTAGGAAACAATGAATGTGG + Intergenic
1135471738 16:22737244-22737266 TCCCAAGGAAAAAAGAAAAGAGG + Intergenic
1137377581 16:47966377-47966399 TCCATAGGAAAAAAAGAAAGAGG + Intergenic
1137498540 16:48992554-48992576 TCCTTAGGATATGAGCAAAGAGG - Intergenic
1138718616 16:59052836-59052858 TTCCTAGAAAATAAGAAATGAGG + Intergenic
1138816971 16:60213735-60213757 TGTCTAGGAAATAGGCAAAAAGG - Intergenic
1139628138 16:68208361-68208383 TACTTAGGAATTAACCAAAGAGG - Intronic
1140323923 16:73981639-73981661 TGTCTGGCAAATAAGCAAAGTGG + Intergenic
1140700751 16:77579457-77579479 TCCTTTGCAAATGAGCAAAGAGG - Intergenic
1141011033 16:80399422-80399444 TACCTAGGAATTAAACAAAGAGG + Intergenic
1141274524 16:82574586-82574608 TCCCAAGGAAAGAAGCAAAATGG + Intergenic
1142419864 16:89963571-89963593 TCCCAAGGAACAAAGCAAACAGG + Intronic
1143407406 17:6686523-6686545 TCCCTGGGAAGTAGGCAGAGTGG + Intronic
1143786996 17:9263169-9263191 TCTCTAAAAAATAAGCAAAAAGG + Intronic
1144180363 17:12745899-12745921 TCCCTAAAAAACAAACAAAGAGG - Exonic
1145114602 17:20197670-20197692 TCCCAAGGACATAAACAAGGTGG + Intronic
1145531972 17:24424970-24424992 TTCCAAGGAAATATGCAAAGAGG - Intergenic
1145627507 17:25815233-25815255 TTCCTACGAAATATTCAAAGAGG - Intergenic
1147006976 17:37411249-37411271 TCCCTAGGAACAAACAAAAGTGG - Exonic
1148597214 17:48866364-48866386 TACCTGGGAAAAAAGCAAAATGG + Intronic
1148743395 17:49905620-49905642 TCCCTAGGAACAGAGCATAGAGG + Intergenic
1149191036 17:54062670-54062692 TACCATGGAAAAAAGCAAAGTGG + Intergenic
1149979390 17:61297582-61297604 CCCTGTGGAAATAAGCAAAGGGG + Intronic
1150272971 17:63878529-63878551 TCCATAGGCATTAAGAAAAGTGG + Intronic
1150278633 17:63915828-63915850 TCCATAGGCATTAAGGAAAGTGG + Intronic
1150279732 17:63922447-63922469 TCCATAGGCATTAAGGAAAGTGG + Intergenic
1153159795 18:2191029-2191051 TCCCTAGGGAAGGAGCAGAGAGG + Intergenic
1155227917 18:23746275-23746297 TTCCTCAGAGATAAGCAAAGGGG + Intronic
1156129722 18:33956563-33956585 TACATAGGAAATAAGAAAATGGG + Intronic
1163923804 19:20319684-20319706 TCCCCAGGAAGTAAGAAAATGGG + Intergenic
1164646135 19:29859864-29859886 TGCCTTGGAATTATGCAAAGTGG - Intergenic
1165385382 19:35507496-35507518 TCCCTAGGAAATAAGCAAAGAGG - Intronic
1167760021 19:51440371-51440393 TCCCCAGAAGATATGCAAAGTGG - Intergenic
925362467 2:3289068-3289090 TGCCTAGGAAGAAAGCAAATGGG - Intronic
925455666 2:4014574-4014596 GCCCTAGGAAATAAGCACACTGG + Intergenic
926273408 2:11385315-11385337 TCCCTAGCAAATCAACACAGTGG - Intergenic
929180035 2:39028216-39028238 TCCCTTAGAAATAAGTAAAGAGG + Intronic
930408277 2:50990491-50990513 TCCCTAGAGAATAAGCTATGTGG - Intronic
931061256 2:58532142-58532164 TCTTTAAGAAATAAGAAAAGAGG + Intergenic
931329641 2:61267413-61267435 TAGCTAGGAAATATGGAAAGTGG + Intronic
931353358 2:61512338-61512360 TCCCAAGGAAATTAGGAAATAGG + Intronic
932684841 2:73859810-73859832 TTCATAGTAAATAATCAAAGTGG - Intronic
932691743 2:73919375-73919397 CCCCAAGGGAATAAGCAAGGTGG - Intronic
934122962 2:88857682-88857704 TCCTGAGGAAAGAAGCAAACAGG + Intergenic
937569095 2:123334321-123334343 CCCCCAGGAAATAGACAAAGTGG + Intergenic
937717080 2:125044802-125044824 TCCTTGGGGAATAAGCACAGTGG - Intergenic
938282133 2:130071978-130072000 CACCCAGGAAACAAGCAAAGTGG - Intergenic
938332760 2:130460550-130460572 CACCCAGGAAACAAGCAAAGTGG - Exonic
938357048 2:130660121-130660143 CACCCAGGAAACAAGCAAAGTGG + Intergenic
938433482 2:131266927-131266949 CACCCAGGAAACAAGCAAAGTGG + Intronic
940775251 2:157876924-157876946 TTGCAAGGAAATGAGCAAAGTGG - Intronic
941865771 2:170332798-170332820 TCAGCAGGAAATATGCAAAGGGG - Intronic
942457689 2:176149292-176149314 TCCCTACGAAACAGGTAAAGTGG + Intergenic
942544695 2:177051247-177051269 TTCACAGAAAATAAGCAAAGAGG + Intergenic
943278741 2:185902302-185902324 TCCTTTGGAAATAAGGAAAATGG - Intergenic
943310856 2:186322988-186323010 TACCTAGGAATTAACCAAAGAGG + Intergenic
944313265 2:198258836-198258858 TCCCTTGGAAATCAATAAAGGGG + Intronic
944489263 2:200241316-200241338 TCCTAAGGAAATAAGAAAACTGG + Intergenic
948587995 2:239032937-239032959 AACATAGGAAATAAACAAAGAGG - Intergenic
948704659 2:239781379-239781401 TCCCAAGGAGAAAAGCAAAGGGG + Intronic
1168974850 20:1956777-1956799 TCCTAAGGAAATAAGCAGACAGG - Intergenic
1169577950 20:6986812-6986834 TACCCAGGGAATAAGCATAGTGG - Intergenic
1170818842 20:19739069-19739091 GCCCTGGGAAATGAGCACAGTGG + Intergenic
1171471971 20:25379383-25379405 TCCTTAGGAAATAAGCAGCAAGG - Intronic
1174257248 20:49266264-49266286 TGCCTAGAAAATAAGGAAAAAGG + Exonic
1175365201 20:58449052-58449074 TCTCCAGGATATCAGCAAAGAGG + Exonic
1177679309 21:24344054-24344076 TCCCTAGAAAATTTGCTAAGAGG - Intergenic
1178223047 21:30683040-30683062 TCCCTAAAAAGTAAGCAAGGTGG + Intergenic
1178350405 21:31869130-31869152 GCCTTAGGAAAGAAGCACAGAGG + Intergenic
1179166545 21:38939529-38939551 TACCTAGGCAACAAGCACAGTGG + Intergenic
1179993532 21:44961061-44961083 TCCCTAAGAAATATCCAAAAAGG - Intronic
1182349187 22:29689263-29689285 CCCCTTCCAAATAAGCAAAGAGG - Intronic
949353378 3:3149914-3149936 ACCCTTGAATATAAGCAAAGAGG + Intronic
950337354 3:12206841-12206863 TCACTAAGAAATTAGCAAATCGG - Intergenic
950923168 3:16715721-16715743 CCCCCAGGAGACAAGCAAAGTGG - Intergenic
950974782 3:17229004-17229026 TCGATAGGAAATAAGAAAAGGGG + Intronic
952670901 3:35967063-35967085 TCACTAGGAATGAAACAAAGAGG - Intergenic
956880445 3:73505885-73505907 TCCCTCTGTAATAAGCACAGAGG + Intronic
959824845 3:110781516-110781538 TCACTGGGAGATAAGAAAAGCGG - Intergenic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
960693164 3:120368699-120368721 TCCCTGTGTAATAAGCAAGGAGG + Intergenic
961037719 3:123653961-123653983 TCCCTCTGAAATGAGCAGAGTGG - Intronic
961041611 3:123682346-123682368 TGCTGAGGAAATGAGCAAAGGGG + Intronic
963365456 3:144328653-144328675 TTCCTAAGAATTAACCAAAGAGG + Intergenic
963789268 3:149566715-149566737 TCTCTAGGAAGTATACAAAGAGG - Intronic
963847746 3:150177165-150177187 TACCTAAGTAATCAGCAAAGTGG + Intergenic
970803098 4:19999905-19999927 AGCCTGGGAAATAAGCAGAGTGG - Intergenic
971652440 4:29295643-29295665 TCCCTAAAAAATAAGTAATGTGG + Intergenic
971753519 4:30679869-30679891 TGCATAGGTAATTAGCAAAGAGG + Intergenic
972664902 4:41155942-41155964 CCCCGAGGAAACAAACAAAGGGG - Intronic
972719133 4:41678253-41678275 TCCCTGGGAAATAAGCCAAAAGG - Intronic
973066506 4:45800744-45800766 ACCCTAGGAAATTAGAAAAAGGG - Intergenic
973733623 4:53848232-53848254 ACCCTTGGAAAAAAGCAATGAGG - Intronic
974199920 4:58623917-58623939 CCCCCAGGAGACAAGCAAAGTGG + Intergenic
974291020 4:59930917-59930939 TACCTAGGAACTAACCAAAGAGG + Intergenic
975049644 4:69844326-69844348 TCCCTAGGATATCAGAAAAGAGG - Exonic
975458952 4:74627914-74627936 TACCTAGGAAATATGCCAAGTGG + Intergenic
975803877 4:78092179-78092201 TTCCTAAGAAAGCAGCAAAGTGG - Intronic
976582926 4:86761050-86761072 TCCCTAGGAAATGGGGTAAGGGG - Intronic
979325396 4:119373079-119373101 CCTCTAGGAAAAATGCAAAGCGG - Intergenic
981014074 4:139955223-139955245 TCCCTGGGAAATAAACTGAGTGG + Intronic
981163205 4:141523627-141523649 TACCTAGGAATTAACCAAAGAGG + Intergenic
982199638 4:152947763-152947785 CATCTAGGAAATAAGTAAAGTGG + Intronic
983291888 4:165817828-165817850 TCCTTAGAAAAGAAGAAAAGTGG - Intergenic
984186667 4:176552556-176552578 TATTTAGGAAATAACCAAAGAGG + Intergenic
984864753 4:184272015-184272037 TCCCTGGGAAAATGGCAAAGGGG + Intergenic
986204265 5:5609276-5609298 GCACTAGGAAATGAGCCAAGAGG + Intergenic
986249121 5:6040125-6040147 TGTCTAGAAAATAAGGAAAGGGG + Intergenic
987022849 5:13892795-13892817 TCCCCAGGAAATAAAACAAGAGG - Intronic
987339234 5:16924542-16924564 TCCTCAGGAAATAATCAAATAGG + Intronic
987669695 5:20990710-20990732 TCCCTGGGCAAGAAGCAAAGAGG - Intergenic
989231940 5:39096744-39096766 TCCCTAGGAAGGAGGGAAAGAGG + Intergenic
990292722 5:54369980-54370002 TACTTAGGAAATAACCAAGGAGG - Intergenic
991107098 5:62856343-62856365 TACCTAGGAATTAACCAAAGAGG - Intergenic
992611113 5:78509525-78509547 CCCCGAGGAAATAAGCAATGAGG + Intronic
992939320 5:81748166-81748188 TGCTTAGGAAATAAGCACATTGG - Intronic
995544104 5:113213141-113213163 ACCCTAGGAAAGAGGCAAATAGG - Intronic
996167219 5:120239241-120239263 TCCCTAGGAAGGAACCACAGAGG + Intergenic
996337258 5:122398281-122398303 TCCTTAGGAGATGAGAAAAGAGG + Intronic
996818154 5:127596412-127596434 GTCCTAAGAGATAAGCAAAGGGG + Intergenic
999093511 5:148958092-148958114 TCCCTAGGATATAAGCACCATGG - Intronic
999498248 5:152121363-152121385 TGCCGAGGAAACAACCAAAGTGG - Intergenic
999632146 5:153582315-153582337 TCCCTAGAAAGTCAGCAAATGGG + Intronic
999831320 5:155322872-155322894 TCCCTAGGAAAAAAAGGAAGGGG - Intergenic
1000921093 5:167138206-167138228 TACCGATGAAATAATCAAAGAGG + Intergenic
1003031241 6:2603341-2603363 TCCCAAGGAAATAAGCCCGGAGG + Intergenic
1003676617 6:8210578-8210600 TCAGTAGGAACTGAGCAAAGTGG - Intergenic
1005213283 6:23494753-23494775 TGCCTCAGAAATTAGCAAAGAGG + Intergenic
1008395626 6:51003420-51003442 ACCGTAGGAATTAACCAAAGTGG - Intergenic
1009596735 6:65745824-65745846 CCCTTAGGAGACAAGCAAAGTGG + Intergenic
1010475270 6:76279097-76279119 TACCTAGGAATTAATCAAAAAGG - Intergenic
1010686036 6:78856345-78856367 TCCCCAGGAAGTAAGGAGAGGGG - Intergenic
1011732233 6:90276713-90276735 TTACTAGGAAATAAGAAAATGGG - Intronic
1012406667 6:98908628-98908650 TGTCTAGGATATAAGCAAAAGGG - Intronic
1013439759 6:110151427-110151449 TTTCTAGGAAATAAACAAGGTGG + Intronic
1014130090 6:117821039-117821061 TCTCTAGGAAATAAGAACATAGG - Intergenic
1014883365 6:126749422-126749444 TCCCTAAGAAACTATCAAAGAGG + Intergenic
1016166383 6:140950029-140950051 TCCCTAGGAAGTACACAAAATGG + Intergenic
1016521258 6:144949629-144949651 TACCTTGGGAATAAGCCAAGTGG + Intergenic
1016556128 6:145340794-145340816 TGCCTAGGAGATAAACAAAGGGG - Intergenic
1016643082 6:146373179-146373201 TACCTAGGAATTAACAAAAGAGG - Intronic
1019441021 7:1046874-1046896 TCCCTGGGAAACAACCAAGGTGG + Intronic
1020518104 7:9151151-9151173 TCACTAGGTTATTAGCAAAGGGG + Intergenic
1023241317 7:38151042-38151064 CCCCCAGTAAACAAGCAAAGTGG + Intergenic
1024894548 7:54242902-54242924 TGACTAGGAATTAAACAAAGAGG + Intergenic
1025867979 7:65404188-65404210 TCCAGAGGAACTAAGCAATGGGG - Intergenic
1028082963 7:86600362-86600384 CCCCCAGGAGACAAGCAAAGTGG + Intergenic
1028484575 7:91343913-91343935 TCCTTACGAAAGAATCAAAGAGG + Intergenic
1029972206 7:104800695-104800717 TCACTAAGAAATACTCAAAGAGG - Intronic
1033102901 7:138491373-138491395 TCCCAAGGACAGAAGGAAAGAGG - Intronic
1033900235 7:146129514-146129536 TCCCTAAGAAATGGGTAAAGAGG + Intronic
1035868252 8:3108746-3108768 TCCCTAGGAAAGACAGAAAGAGG + Exonic
1037320124 8:17633738-17633760 TCCCTAGGGAAGAAGCAGGGAGG - Intronic
1040087891 8:43364861-43364883 CCCCTAGGAGAAAAGCCAAGTGG + Intergenic
1040372251 8:46788452-46788474 TCCCCAGAAAATGAGCAAAGAGG - Intergenic
1040594716 8:48825947-48825969 TCCCTAGGAAAGAATCAGTGTGG - Intergenic
1040785042 8:51155564-51155586 TGCCTAGGAAAACAGCAAAAAGG - Intergenic
1042054686 8:64751575-64751597 TCCCTGGGAAATAATCATAGAGG - Intronic
1043722213 8:83558990-83559012 TCCTTAGCAAATATGCAAATAGG + Intergenic
1044535401 8:93351897-93351919 AACCAAGGAAATAAGTAAAGAGG + Intergenic
1045695874 8:104808148-104808170 TCCTAATGAAATAACCAAAGAGG - Intronic
1046375553 8:113375611-113375633 TCCTTAGGAATGAAGCTAAGAGG + Intronic
1048214583 8:132482336-132482358 TCCCTAGTGTATAAGAAAAGAGG + Intergenic
1050806942 9:9692845-9692867 TACCTAGGAATTAACCAAAGAGG - Intronic
1051235416 9:14993610-14993632 TCCCCAGGAAATGCGCCAAGAGG - Intergenic
1052198892 9:25753264-25753286 TCCTTGGGTAATATGCAAAGCGG - Intergenic
1052727846 9:32251104-32251126 TTCCAAGGTAAAAAGCAAAGTGG + Intergenic
1055568246 9:77590459-77590481 TTCCCAGCAGATAAGCAAAGAGG - Intronic
1056091379 9:83208853-83208875 GCTCTAGGAAATAAGAAAAAGGG - Intergenic
1057773962 9:97990459-97990481 TCACTGGGGAATAAGCACAGAGG - Intronic
1060019787 9:120119131-120119153 TCCCTAGGAGAGAAACAAAATGG + Intergenic
1061264969 9:129499582-129499604 TCCCTGGGATGGAAGCAAAGAGG + Intergenic
1185713995 X:2326669-2326691 TCCCTAGGAATATTGCAAAGTGG - Intronic
1187752577 X:22483895-22483917 TCCCTAGTAAATAAGAAAACAGG + Intergenic
1189257843 X:39654251-39654273 TCACCAGAAAATAAGCAATGGGG + Intergenic
1189267348 X:39727069-39727091 TTCCTAGGACATAAGAGAAGAGG + Intergenic
1189881468 X:45497893-45497915 TCTCTAAGAACTAAGCAAAGGGG - Intergenic
1190455217 X:50620469-50620491 CCCCAAGGAAATAACCTAAGAGG - Intronic
1193080214 X:77399203-77399225 TCCCAAGGGAATTGGCAAAGTGG + Intergenic
1193121607 X:77828608-77828630 TCAGTAGGAAATATGCAAGGAGG + Exonic
1194247975 X:91538279-91538301 CCCCCAGGAGATAAGTAAAGTGG + Intergenic
1194781411 X:98029070-98029092 CCCCCAGGAGAGAAGCAAAGTGG - Intergenic
1194917572 X:99723674-99723696 TCCCCAGGAGAGGAGCAAAGTGG + Intergenic
1195060285 X:101187685-101187707 TCCCCAGGAAGTAAGGAGAGGGG + Intergenic
1195346328 X:103954089-103954111 CCCCCAGGAGACAAGCAAAGTGG + Intronic
1195361125 X:104084756-104084778 CCCCCAGGAGACAAGCAAAGTGG - Intergenic
1195847180 X:109241331-109241353 TCCCCAAGAAAAAAGGAAAGGGG + Intergenic
1195951674 X:110281845-110281867 TGGATAGGAAATAAGCAAATGGG - Intronic
1196993438 X:121354006-121354028 CACCCAGGAAATAACCAAAGGGG - Intergenic
1199235071 X:145482862-145482884 TCCCTTCAAAATAAGCAATGAGG - Intergenic
1199368436 X:147016694-147016716 TCCCGAGGTGCTAAGCAAAGAGG - Intergenic
1199381840 X:147180855-147180877 TCTCTGGGAAAGAAGCAGAGAGG + Intergenic
1199808612 X:151327316-151327338 TCCCTAGGGAAGCAGCAGAGTGG + Intergenic
1201912110 Y:19143411-19143433 TATCTAGGAAACAAGCAAGGTGG - Intergenic