ID: 1165385964

View in Genome Browser
Species Human (GRCh38)
Location 19:35510848-35510870
Sequence GCTGGAGAGACTGCCGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165385955_1165385964 15 Left 1165385955 19:35510810-35510832 CCGTCAGCCAAGGGGTTGGACAG 0: 1
1: 0
2: 0
3: 13
4: 188
Right 1165385964 19:35510848-35510870 GCTGGAGAGACTGCCGGCTCTGG 0: 1
1: 0
2: 2
3: 19
4: 168
1165385961_1165385964 -9 Left 1165385961 19:35510834-35510856 CCATTGACCAGGAGGCTGGAGAG 0: 1
1: 0
2: 1
3: 27
4: 264
Right 1165385964 19:35510848-35510870 GCTGGAGAGACTGCCGGCTCTGG 0: 1
1: 0
2: 2
3: 19
4: 168
1165385957_1165385964 8 Left 1165385957 19:35510817-35510839 CCAAGGGGTTGGACAGGCCATTG 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1165385964 19:35510848-35510870 GCTGGAGAGACTGCCGGCTCTGG 0: 1
1: 0
2: 2
3: 19
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165385964 Original CRISPR GCTGGAGAGACTGCCGGCTC TGG Intronic
900398887 1:2464797-2464819 GATGGAGACACTGCGGACTCTGG + Intronic
900573754 1:3372918-3372940 GATGCAGAGCCTGCGGGCTCGGG + Intronic
900642192 1:3693096-3693118 GCTGGAGACATGGCTGGCTCTGG - Intronic
901231072 1:7642014-7642036 GGTGGAGAGGCAGCAGGCTCTGG - Intronic
901519908 1:9775551-9775573 TGTGGAGATACTGCTGGCTCAGG - Intronic
902443836 1:16448951-16448973 GCTGGAAAGAGTGCAGGCTTGGG - Intronic
903777370 1:25801164-25801186 CCAGGAGAGACTGGCGGCTGGGG + Intronic
904836331 1:33339626-33339648 GCTGGAGAGCCCGTCAGCTCTGG - Intronic
904839665 1:33364166-33364188 ACTGGAGGGTCTGCCTGCTCTGG + Intronic
905309208 1:37037795-37037817 GCTGGAGATAGTGCCAGCCCTGG - Intergenic
905449483 1:38047227-38047249 GCAGCAGGGATTGCCGGCTCCGG + Intergenic
905940440 1:41858966-41858988 GCTGGAGAGGTTGGCAGCTCAGG + Intronic
906529647 1:46516257-46516279 CCTGGAGACACTGCCTGCTCAGG - Intergenic
909397885 1:75191366-75191388 GCTGGAGAGAGTGGGGGCTGCGG - Intergenic
919761522 1:201101224-201101246 GGTGGAGAGGCTGCGGGCTGGGG + Intronic
920095453 1:203483619-203483641 GCTGGAGAAACTGCCCGGCCTGG + Exonic
921646988 1:217630897-217630919 GCTGGTGAGGCTGGCGGCCCTGG - Exonic
923335723 1:232968477-232968499 GCTAGAAAGACTGCTGGCTGTGG - Intronic
1064146323 10:12828944-12828966 GCTGGAGTGGCTCGCGGCTCTGG - Exonic
1066446698 10:35490636-35490658 GCTGGAAAGACTTCCGGCTCTGG - Intronic
1067045895 10:42985033-42985055 GCTGGAGAGAGTGCAGCCTCCGG + Intergenic
1067771771 10:49131723-49131745 GCTGGAGAGAAGGCGGGCTCAGG - Exonic
1067778060 10:49177137-49177159 GCTGGTGAGTCTGATGGCTCAGG - Intronic
1069589631 10:69633876-69633898 GCTGGTGAGGCTGCAGGGTCGGG + Intergenic
1069817737 10:71209290-71209312 GCAGGAGTGGCTGCCGGCTTGGG - Intergenic
1069961992 10:72084498-72084520 GCTGGAGACACTGAGGGCTTTGG + Intronic
1070788931 10:79178388-79178410 GGTGGAGAGAATGGCGCCTCTGG - Intronic
1071530899 10:86389787-86389809 GCTGGAGAGACTGAGGGCCAGGG + Intergenic
1073051143 10:100668160-100668182 CCTGGAGATGCTGCCGGCTCAGG - Intergenic
1073355463 10:102850377-102850399 GGTGGACAGACTGGCCGCTCAGG - Intergenic
1074720916 10:116264386-116264408 GATTGACAGAATGCCGGCTCAGG + Intronic
1074917605 10:117972347-117972369 GCTGCAGGGACTGCAGGCCCTGG + Intergenic
1077376835 11:2209223-2209245 GCTGGAGACACTGCCAGCTCAGG + Intergenic
1083264454 11:61540113-61540135 GCTGGAGAGAGTGACGAATCGGG - Intronic
1083546416 11:63552260-63552282 GGTGGAGAGAGTGCCAGCTCTGG + Intergenic
1083856615 11:65396240-65396262 AGTGCAGAGGCTGCCGGCTCAGG + Intronic
1084598468 11:70131147-70131169 GCTGCAGAGGCTGCTGCCTCAGG + Intronic
1085350180 11:75793238-75793260 GCTGGAGAGAATGTCCGTTCTGG - Intronic
1085395595 11:76205669-76205691 GCTGAAGGGAGTGCCTGCTCAGG - Intronic
1085533659 11:77205789-77205811 GCTGGAGAGTCCGGCTGCTCGGG + Intronic
1090777553 11:129978721-129978743 GCTGCAGAGACTATCAGCTCAGG + Intronic
1091715364 12:2772790-2772812 GCAGCAGAGACTCCCAGCTCTGG - Intergenic
1093287016 12:17276344-17276366 GCTGGTGAGACTCCAGGCACTGG - Intergenic
1094348630 12:29498621-29498643 GGTGGAGAGAATGCAGGCACAGG + Intergenic
1096215516 12:49795855-49795877 GCGGGACAGACTGGCGGCCCTGG - Exonic
1098975403 12:76896717-76896739 GCTGCAGTGACTGCAGGCTTAGG + Intergenic
1100346159 12:93733633-93733655 CCTGGGGAGGCTGCCTGCTCAGG + Intronic
1101930096 12:109006744-109006766 GCTGGAGAGACCTGAGGCTCTGG + Intronic
1102136915 12:110583090-110583112 GCTGAGGAGAGAGCCGGCTCCGG - Exonic
1102571333 12:113828720-113828742 GCTTGGGAGGCTGCCTGCTCTGG + Intronic
1104763614 12:131312953-131312975 GCTGGGGAAACTCCTGGCTCAGG - Intergenic
1104785229 12:131444531-131444553 GATGGAGAGGCTGCCGCCCCGGG + Intergenic
1104815887 12:131645124-131645146 GCTGGGGAAACTCCTGGCTCAGG + Intergenic
1108416340 13:50201486-50201508 GATGGTGGGACTGCTGGCTCTGG + Intronic
1115754490 14:36518571-36518593 GCTGGAGAGAGGGCCGGGCCGGG + Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118321023 14:64753508-64753530 GCGGGAGAGGCTGCTGGCTGAGG - Intronic
1119437293 14:74605721-74605743 GCTGGGGTGACGGCTGGCTCAGG - Intronic
1119620100 14:76125482-76125504 CCTGTAGAGGCTGCCGGCTTTGG + Intergenic
1119942254 14:78653467-78653489 CCTGGAGAGACTCCATGCTCAGG - Intronic
1121309002 14:92924676-92924698 GCTGGAGAGCCTGCTGGGTGTGG - Intronic
1121861691 14:97324709-97324731 GCTGAAGAGAATGTGGGCTCAGG + Intergenic
1122079148 14:99254716-99254738 CCTGGAGGGACAGCCGGCCCGGG + Intronic
1127588198 15:60397791-60397813 GCTGAAGGGACGGCCGGCACTGG - Intronic
1128112677 15:65086556-65086578 GCTGGGGAGGCTGCCTGCACAGG - Intergenic
1128332225 15:66763306-66763328 CCTGGGGAGACTGGCGGCTCTGG + Intronic
1129029756 15:72609670-72609692 GCAGGAGAGACTGCTGGAGCAGG + Intergenic
1129596917 15:76972808-76972830 GCGGGAGAGTCCGCCGGCCCGGG - Intergenic
1130259558 15:82344662-82344684 GCTGGAGAGGCTGCGGGAGCTGG - Exonic
1130259562 15:82344680-82344702 GCTGGAGAGGCTGCGGGAGCTGG - Exonic
1130269120 15:82434506-82434528 GCTGGAGAGGCTGCGGGAGCTGG + Exonic
1130281704 15:82524506-82524528 GCTGGAGAGGCTGCGGGAGCTGG + Intergenic
1130281707 15:82524524-82524546 GCTGGAGAGGCTGCTGGAGCTGG + Intergenic
1130473072 15:84240668-84240690 GCTGGAGAGGCTGCGGGAGCTGG + Exonic
1130473076 15:84240686-84240708 GCTGGAGAGGCTGCGGGAGCTGG + Exonic
1130480486 15:84354733-84354755 GCTGGAGAGGCTGCGGGAGCTGG + Intergenic
1130480490 15:84354751-84354773 GCTGGAGAGGCTGCGGGAGCTGG + Intergenic
1130491222 15:84433008-84433030 GCTGGAGAGGCTGCGGGAGCTGG - Intergenic
1130491226 15:84433026-84433048 GCTGGAGAGGCTGCGGGAGCTGG - Intergenic
1130502805 15:84511808-84511830 GCTGGAGAGGCTGCGGGAGCTGG - Intergenic
1130502809 15:84511826-84511848 GCTGGAGAGGCTGCGGGAGCTGG - Intergenic
1130595361 15:85245276-85245298 GCTGGAGAGGCTGCGGGAGCTGG + Intergenic
1130866352 15:87936230-87936252 GCTGGGGAGGCTCCTGGCTCAGG + Intronic
1133381804 16:5337092-5337114 GCTGAAGAGATGGCCGGCTGGGG + Intergenic
1136414533 16:30095544-30095566 CCCGGAGAGGCTGCTGGCTCTGG - Exonic
1138456975 16:57126687-57126709 GCAGGAAAGACAGCAGGCTCAGG + Intronic
1140767830 16:78176358-78176380 GCTGGAGAGCGTGCAGACTCAGG + Intronic
1141390130 16:83657597-83657619 GCTGGAGAGGCTGTGGGCTGGGG + Intronic
1141941473 16:87278871-87278893 ACTGGAGAGGCTGGCAGCTCAGG - Intronic
1146296500 17:31654457-31654479 GATTGGGAGACTGCTGGCTCAGG - Intergenic
1146756048 17:35432832-35432854 TCTGGGGAGTCTGCTGGCTCGGG - Intronic
1147134062 17:38425258-38425280 GCAGGAGAGAGAGCAGGCTCCGG - Intergenic
1147675114 17:42199936-42199958 GAAGGAGAGCCTGCCTGCTCAGG - Exonic
1151854384 17:76710741-76710763 GCGGGCGAGGCCGCCGGCTCGGG + Exonic
1152133398 17:78490725-78490747 GATGTAGAGGATGCCGGCTCTGG + Exonic
1152272421 17:79332425-79332447 GCTGGAGAGGAGGCAGGCTCTGG + Intronic
1152613169 17:81325530-81325552 GCTGGGGAGACTGGAGACTCTGG + Intronic
1152631185 17:81411341-81411363 GCTGGAGAGACGGGAGGCACCGG + Intronic
1152751303 17:82063650-82063672 ACTGGAGACACTGCTGGTTCTGG - Intronic
1153304140 18:3617058-3617080 CCTGGAGAGACTGCAAGCTCAGG + Intronic
1153460268 18:5325278-5325300 GCTGGAGAGACTGCCTGAGATGG + Intergenic
1153774274 18:8439100-8439122 GCTGGAGAAACTGCCTGCTGTGG - Intergenic
1157295361 18:46438257-46438279 GCTGGAGACACTGCTGCCTTAGG + Intronic
1159961282 18:74557511-74557533 GCTGGTGAGTCTGTGGGCTCCGG - Intronic
1161429702 19:4224475-4224497 GATGCAGAGACTCCAGGCTCAGG + Exonic
1161466222 19:4432137-4432159 CCTGGAGACCCTGCCGGCCCAGG + Exonic
1161723617 19:5916548-5916570 GCTTGTGAGACTGCCTGTTCTGG + Exonic
1162295566 19:9811114-9811136 GCTGGAGGGAATGCCGGCCCTGG - Exonic
1163626259 19:18391664-18391686 GCTGATGAGGCTGCTGGCTCAGG - Exonic
1163650511 19:18515189-18515211 CCTGCAGAGACTGCCAGCTCGGG + Intronic
1164487001 19:28667046-28667068 GCTGTAGAGTCAGCCTGCTCTGG + Intergenic
1165140616 19:33697866-33697888 GCTGAAGACACAGCCGGCCCTGG + Intronic
1165255105 19:34572872-34572894 TCTGGAGAGACTGCCCTCCCAGG + Intergenic
1165289931 19:34874817-34874839 GCTGCAGAGTCTGCAGGCCCTGG + Intergenic
1165385964 19:35510848-35510870 GCTGGAGAGACTGCCGGCTCTGG + Intronic
1165696857 19:37907273-37907295 GCTGGAGACGCCGCCAGCTCCGG - Exonic
1166357416 19:42235392-42235414 GCTGGAGAGGGGGCAGGCTCAGG - Intronic
925024687 2:598549-598571 GCTGGAGAGACTCCCAACACAGG + Intergenic
926045644 2:9707860-9707882 GATGGGGAGGCTGCAGGCTCAGG + Intergenic
929454332 2:42055347-42055369 TCTGCAGATACTGCCCGCTCCGG - Exonic
929920141 2:46165980-46166002 CCTGGAGAGACTCCCCACTCTGG - Intronic
932793392 2:74674753-74674775 GCGGGAGAGCCTGCCCCCTCTGG - Intronic
937916339 2:127100861-127100883 GCTGGAGAGGCTGCCCACTCAGG - Intronic
940883355 2:158968658-158968680 GCTGGAGCGGCGGCCGCCTCGGG + Exonic
941104892 2:161341121-161341143 GCGGGCGAGGCCGCCGGCTCGGG + Intronic
946568773 2:220998141-220998163 TCTGGAGATACTGACTGCTCTGG + Intergenic
947201677 2:227619851-227619873 GCTGAAGAGACTTCAGGCTAAGG + Intronic
1168892441 20:1303661-1303683 GCTGGAGGGACTGGGGGCTGAGG - Intronic
1169373205 20:5044398-5044420 ACTTGAGAGACTGCAGCCTCAGG - Intergenic
1181106768 22:20580232-20580254 GCTGGTGAGATTGCCGCTTCAGG + Intronic
1181416685 22:22764668-22764690 GCTGCAGAGCCTTCCTGCTCTGG + Intronic
1181671368 22:24427043-24427065 GGTGGAGAGGCTGCCGGAGCTGG + Intronic
1183100910 22:35583516-35583538 GCTGGACAGACTCCCTGCTAAGG - Intergenic
1183739462 22:39662011-39662033 GCTGGAGCGACGGCTGGCCCAGG - Exonic
1184202083 22:42976910-42976932 GCTGGAGAAACTTCTAGCTCAGG - Intronic
1185364532 22:50431322-50431344 GCTGGGGAGTCTCCAGGCTCCGG - Exonic
951162429 3:19441044-19441066 GGAGGAGGGACTGCCTGCTCTGG + Intronic
951449651 3:22822202-22822224 GCTGGAGAAACTGCCCTCTGAGG - Intergenic
952736422 3:36695797-36695819 CCTGGATAGACTGCTGGCCCAGG + Intergenic
955093114 3:55771794-55771816 GGTGGAGAGCCTGCCTCCTCAGG - Intronic
955878771 3:63521969-63521991 CCTGGAGAGGCTGCCTGCTTTGG - Intronic
961288835 3:125828838-125828860 GCTGGAGAGGCGGCAGGGTCAGG + Intergenic
968547933 4:1208079-1208101 GCTGCAGGGAGTGCCGGCTGCGG + Intronic
968664665 4:1814641-1814663 GCTGGGGCGACTGACGGCGCTGG - Intronic
968704077 4:2069973-2069995 GCTGGAGGGCCTGGCGGCACGGG - Intergenic
969153572 4:5190943-5190965 GTTGTAGAGAGTGCAGGCTCTGG - Intronic
972418700 4:38867570-38867592 GCTGGAGAGGCGGCGCGCTCTGG + Intergenic
976757033 4:88509688-88509710 ACTGAAGAAACTGCAGGCTCTGG + Intergenic
981361833 4:143854902-143854924 GTGGGAGAGATTTCCGGCTCTGG + Intergenic
996868337 5:128156002-128156024 GCTGGAGAGAGTCCCTGGTCTGG - Intronic
998295625 5:140966710-140966732 GCTGGGGAAGCTGCCGCCTCCGG + Exonic
998515061 5:142745454-142745476 GAGGGAGAGACAGCCTGCTCTGG + Intergenic
999311393 5:150554171-150554193 GCTGGTGAGACTGCCAGCCACGG + Exonic
999373540 5:151070764-151070786 GCTGGGGAAACTGCAGCCTCAGG + Intronic
999648658 5:153744099-153744121 ATTGGAGACACAGCCGGCTCTGG - Intronic
1002073598 5:176695293-176695315 GCTGGAGAGAGTGCCGATTCTGG + Intergenic
1003607881 6:7581179-7581201 CCTGGAGTAACTGCCGCCTCAGG - Exonic
1007760109 6:44128273-44128295 GCTGGAGAGGCGGCCGGCCCCGG + Intronic
1008410649 6:51174699-51174721 CCTGAAGAGGCTGCAGGCTCTGG + Intergenic
1015254460 6:131162373-131162395 GCTGGAAAGAGTGCAGGCTTTGG + Intronic
1018432126 6:163730695-163730717 GCTGAGCAGACTGCCGGCTGGGG + Intergenic
1018850115 6:167581612-167581634 CATGGAGAGACTGTCTGCTCAGG + Intergenic
1019279117 7:191504-191526 GCTGGCGAGGCTGCTGGCCCAGG + Intergenic
1019279698 7:193517-193539 GCTGGAGAAACTGCCGCCCGCGG + Exonic
1026117869 7:67511493-67511515 GTTGGAGAGACTGAGGGCTCAGG + Intergenic
1026994494 7:74606640-74606662 GCAGGAGCCACTTCCGGCTCTGG - Intergenic
1032069387 7:128794502-128794524 GCTGGAGGAGCTGCGGGCTCAGG + Exonic
1033253456 7:139778797-139778819 CCTGGAGAGGCTCCCGGCTGGGG - Intronic
1034441189 7:151086780-151086802 GCAGCAGAGCCTGGCGGCTCCGG + Exonic
1034672820 7:152870889-152870911 GCTGCAGAGACCCCCGGCTCTGG - Intergenic
1034672832 7:152870941-152870963 GCTGCAGAGACCCCCGGCTCTGG - Intergenic
1034672844 7:152870993-152871015 GCTGCAGAGACCCCCGGCTCTGG - Intergenic
1034672856 7:152871045-152871067 GCTGCAGAGACCCCCGGCTCTGG - Intergenic
1035520363 8:271273-271295 GCTGGGGAGCCTGCAGGCTCTGG - Intergenic
1035856255 8:2979555-2979577 TCTGGAGAGACTGTGGCCTCTGG - Intronic
1041726627 8:61023878-61023900 GCCGGAGAGACTGGCTGCTGAGG + Intergenic
1046055399 8:109072298-109072320 GCTAAAGAGACTGCCTTCTCTGG - Intergenic
1048981640 8:139705709-139705731 TCTGGGGAGAGTGCCTGCTCGGG - Intergenic
1049858235 8:144877678-144877700 ACTGGTGAGAATGCAGGCTCAGG - Exonic
1057759387 9:97860433-97860455 GCTGGAGAGAGGGCCGGGGCAGG - Intergenic
1057815467 9:98290724-98290746 GCTGGAGGGACAGCCGACGCTGG + Exonic
1057819835 9:98322288-98322310 GCTGGAGAGACGCCAGGTTCTGG - Intronic
1057855209 9:98596266-98596288 GCTGGAAAGAGTGCTGGCACCGG + Intronic
1059016295 9:110519658-110519680 GATTGAGTGACTGCCAGCTCAGG - Intronic
1062644153 9:137538211-137538233 GCTGGGGAGGCTGCCGGCCTGGG - Intronic
1195393063 X:104383345-104383367 GCCGGAGAGAGTACAGGCTCTGG + Intergenic
1200067117 X:153509276-153509298 GCTGGGGAGACTGCTGTCCCTGG - Exonic
1200094578 X:153651185-153651207 GCTGCAAAGACTGCCAGCCCTGG - Exonic
1200175876 X:154116077-154116099 GCTGGAGAGACTGTCCTCCCAGG + Intergenic
1200308948 X:155057638-155057660 GCTGGACAGTGTCCCGGCTCAGG + Exonic