ID: 1165387212

View in Genome Browser
Species Human (GRCh38)
Location 19:35517583-35517605
Sequence CCTGCCTCCAGGCCTTTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165387212_1165387222 29 Left 1165387212 19:35517583-35517605 CCATGCAAAGGCCTGGAGGCAGG No data
Right 1165387222 19:35517635-35517657 TGGCTGGAGCAGTGTTGGGATGG No data
1165387212_1165387217 9 Left 1165387212 19:35517583-35517605 CCATGCAAAGGCCTGGAGGCAGG No data
Right 1165387217 19:35517615-35517637 ACTGTATTTGAGAACCATTGTGG No data
1165387212_1165387218 13 Left 1165387212 19:35517583-35517605 CCATGCAAAGGCCTGGAGGCAGG No data
Right 1165387218 19:35517619-35517641 TATTTGAGAACCATTGTGGCTGG No data
1165387212_1165387220 24 Left 1165387212 19:35517583-35517605 CCATGCAAAGGCCTGGAGGCAGG No data
Right 1165387220 19:35517630-35517652 CATTGTGGCTGGAGCAGTGTTGG No data
1165387212_1165387221 25 Left 1165387212 19:35517583-35517605 CCATGCAAAGGCCTGGAGGCAGG No data
Right 1165387221 19:35517631-35517653 ATTGTGGCTGGAGCAGTGTTGGG No data
1165387212_1165387223 30 Left 1165387212 19:35517583-35517605 CCATGCAAAGGCCTGGAGGCAGG No data
Right 1165387223 19:35517636-35517658 GGCTGGAGCAGTGTTGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165387212 Original CRISPR CCTGCCTCCAGGCCTTTGCA TGG (reversed) Intergenic
No off target data available for this crispr