ID: 1165387215

View in Genome Browser
Species Human (GRCh38)
Location 19:35517608-35517630
Sequence GGTTCTCAAATACAGTAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165387215_1165387224 25 Left 1165387215 19:35517608-35517630 CCTGCCTACTGTATTTGAGAACC No data
Right 1165387224 19:35517656-35517678 GGGAGAAGCTAAAGTCAAAGAGG No data
1165387215_1165387223 5 Left 1165387215 19:35517608-35517630 CCTGCCTACTGTATTTGAGAACC No data
Right 1165387223 19:35517636-35517658 GGCTGGAGCAGTGTTGGGATGGG No data
1165387215_1165387220 -1 Left 1165387215 19:35517608-35517630 CCTGCCTACTGTATTTGAGAACC No data
Right 1165387220 19:35517630-35517652 CATTGTGGCTGGAGCAGTGTTGG No data
1165387215_1165387225 26 Left 1165387215 19:35517608-35517630 CCTGCCTACTGTATTTGAGAACC No data
Right 1165387225 19:35517657-35517679 GGAGAAGCTAAAGTCAAAGAGGG No data
1165387215_1165387221 0 Left 1165387215 19:35517608-35517630 CCTGCCTACTGTATTTGAGAACC No data
Right 1165387221 19:35517631-35517653 ATTGTGGCTGGAGCAGTGTTGGG No data
1165387215_1165387222 4 Left 1165387215 19:35517608-35517630 CCTGCCTACTGTATTTGAGAACC No data
Right 1165387222 19:35517635-35517657 TGGCTGGAGCAGTGTTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165387215 Original CRISPR GGTTCTCAAATACAGTAGGC AGG (reversed) Intergenic
No off target data available for this crispr