ID: 1165387217

View in Genome Browser
Species Human (GRCh38)
Location 19:35517615-35517637
Sequence ACTGTATTTGAGAACCATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165387212_1165387217 9 Left 1165387212 19:35517583-35517605 CCATGCAAAGGCCTGGAGGCAGG No data
Right 1165387217 19:35517615-35517637 ACTGTATTTGAGAACCATTGTGG No data
1165387208_1165387217 26 Left 1165387208 19:35517566-35517588 CCAAGCAGGGGGAACAGCCATGC No data
Right 1165387217 19:35517615-35517637 ACTGTATTTGAGAACCATTGTGG No data
1165387214_1165387217 -2 Left 1165387214 19:35517594-35517616 CCTGGAGGCAGGAGCCTGCCTAC No data
Right 1165387217 19:35517615-35517637 ACTGTATTTGAGAACCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165387217 Original CRISPR ACTGTATTTGAGAACCATTG TGG Intergenic
No off target data available for this crispr