ID: 1165387221

View in Genome Browser
Species Human (GRCh38)
Location 19:35517631-35517653
Sequence ATTGTGGCTGGAGCAGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165387212_1165387221 25 Left 1165387212 19:35517583-35517605 CCATGCAAAGGCCTGGAGGCAGG No data
Right 1165387221 19:35517631-35517653 ATTGTGGCTGGAGCAGTGTTGGG No data
1165387215_1165387221 0 Left 1165387215 19:35517608-35517630 CCTGCCTACTGTATTTGAGAACC No data
Right 1165387221 19:35517631-35517653 ATTGTGGCTGGAGCAGTGTTGGG No data
1165387216_1165387221 -4 Left 1165387216 19:35517612-35517634 CCTACTGTATTTGAGAACCATTG No data
Right 1165387221 19:35517631-35517653 ATTGTGGCTGGAGCAGTGTTGGG No data
1165387214_1165387221 14 Left 1165387214 19:35517594-35517616 CCTGGAGGCAGGAGCCTGCCTAC No data
Right 1165387221 19:35517631-35517653 ATTGTGGCTGGAGCAGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165387221 Original CRISPR ATTGTGGCTGGAGCAGTGTT GGG Intergenic
No off target data available for this crispr