ID: 1165387224

View in Genome Browser
Species Human (GRCh38)
Location 19:35517656-35517678
Sequence GGGAGAAGCTAAAGTCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165387219_1165387224 4 Left 1165387219 19:35517629-35517651 CCATTGTGGCTGGAGCAGTGTTG No data
Right 1165387224 19:35517656-35517678 GGGAGAAGCTAAAGTCAAAGAGG No data
1165387215_1165387224 25 Left 1165387215 19:35517608-35517630 CCTGCCTACTGTATTTGAGAACC No data
Right 1165387224 19:35517656-35517678 GGGAGAAGCTAAAGTCAAAGAGG No data
1165387216_1165387224 21 Left 1165387216 19:35517612-35517634 CCTACTGTATTTGAGAACCATTG No data
Right 1165387224 19:35517656-35517678 GGGAGAAGCTAAAGTCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165387224 Original CRISPR GGGAGAAGCTAAAGTCAAAG AGG Intergenic
No off target data available for this crispr